Transcript: Human XR_929852.2

PREDICTED: Homo sapiens aminopeptidase O (putative) (AOPEP), transcript variant X7, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
AOPEP (84909)
Length:
3350
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_929852.2
NBCI Gene record:
AOPEP (84909)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_929852.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000281747 GAGGGAGCAGTTAGACTATTA pLKO_005 815 3UTR 100% 13.200 18.480 N AOPEP n/a
2 TRCN0000073861 GCACAAGTTCACGAAAGCCTA pLKO.1 2483 3UTR 100% 2.640 3.696 N AOPEP n/a
3 TRCN0000073860 GCTGGTATTACTATGTAACTA pLKO.1 1192 3UTR 100% 5.625 4.500 N AOPEP n/a
4 TRCN0000271612 GACATCAAAGGAGGGATTATG pLKO_005 2942 3UTR 100% 13.200 9.240 N AOPEP n/a
5 TRCN0000073859 GCTGTGATTTATCTGTGTTAA pLKO.1 661 3UTR 100% 13.200 9.240 N AOPEP n/a
6 TRCN0000271564 TCATTCCTCATCGGGTCTTTG pLKO_005 1408 3UTR 100% 10.800 7.560 N AOPEP n/a
7 TRCN0000073858 CCACAGCAAGATTCTTTCATT pLKO.1 2879 3UTR 100% 5.625 3.938 N AOPEP n/a
8 TRCN0000073862 CTGCTGTGATTTATCTGTGTT pLKO.1 659 3UTR 100% 4.950 3.465 N AOPEP n/a
9 TRCN0000271610 CTCATCTGAAATGGAATATAA pLKO_005 488 3UTR 100% 15.000 9.000 N AOPEP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_929852.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04446 pDONR223 100% 64.4% None 1_218del;1581_1877del;2676_3350del n/a
2 TRCN0000477624 CTGAAATCTACATCCGATCTATAA pLX_317 18.9% 64.4% V5 1_218del;1581_1877del;2676_3350del n/a
Download CSV