Construct: ORF TRCN0000477666
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF005673.1_s317c1
- Derived from:
- ccsbBroadEn_09713
- DNA Barcode:
- GCCTTCTCTTAGATCAAATCATTC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- FBXO16 (157574)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000477666
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 157574 | FBXO16 | F-box protein 16 | NM_172366.4 | 99.8% | 100% | 594T>C |
| 2 | human | 157574 | FBXO16 | F-box protein 16 | NM_001258211.1 | 95.7% | 95.8% | 97_98ins36;558T>C |
| 3 | mouse | 50759 | Fbxo16 | F-box protein 16 | XM_006519230.3 | 82.7% | 85.2% | (many diffs) |
| 4 | mouse | 50759 | Fbxo16 | F-box protein 16 | XM_006519231.3 | 82% | 84.9% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 945
- ORF length:
- 876
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gatggcattt gcacctccaa aaaacacaga tggtcccaaa atgcagacaa 121 agatgagcac ctggacaccc ctaaaccatc agctattgaa tgaccgggta tttgaagaaa 181 gaagagccct gcttggcaaa tggtttgaca aatggacaga ctctcaaaga agaagaatcc 241 tcacaggcct gttggagcgc tgctcgctgt cccagcaaaa gttctgctgt cgaaagcttc 301 aagagaaaat tccagcagaa gccctggact ttacaaccaa gcttccaagg gtgttatctt 361 tatacatctt ttctttcctg gaccctcgga gcctttgtcg ttgtgcacag gtgtgctggc 421 attggaagaa ccttgctgag ctggaccagc tctggatgct gaaatgttta cggtttaact 481 ggtacatcaa tttctctcca actccctttg agcaggggat ctggaagaag cactatattc 541 aaatggtgaa agaacttcat attaccaagc ctaagacacc cccaaaGGAT GGATTTGTAA 601 TCGCTGACGT TCAACTAGTT ACAAGCAATT CTCCAGAGGA AAAACAGTCC CCTTTATCAG 661 CCTTTCGGTC CTCTTCCTCT TTAAGAAAGA AGAATAACTC AGGGGAGAAA GCACTTCCAC 721 CCTGGCGATC TTCTGATAAG CACCCAACAG ATATCATTCG TTTTAATTAC CTAGACAACC 781 GTGACCCCAT GGAGACTGTC CAGCAAGGAA GAAGAAAAAG AAACCAAATG ACCCCAGACT 841 TCAGCCGACA GTCACATGAT AAGAAAAATA AATTGCAGGA CAGAACTAGG CTAAGAAAAG 901 CACAATCAAT GATGTCGAGG AGAAATCCCT TCCCACTATG TCCCTTGCCA ACTTTCTTGT 961 ACAAAGTGGT TGATATCGGT AAGCCTATCC CTAACCCTCT CCTCGGTCTC GATTCTACGT 1021 AGTAATGAAC TAGTCCGTAA CTTGAAAGTA TTTCGATTTC TTGGCTTTAT ATATCTTGTG 1081 GAAAGGACGA GCCTTCTCTT AGATCAAATC ATTCACGCGT TAAGTCgaca atcaacctct 1141 ggattacaaa atttgtgaaa gatt