Transcript: Human NM_001258211.1

Homo sapiens F-box protein 16 (FBXO16), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-02-23
Taxon:
Homo sapiens (human)
Gene:
FBXO16 (157574)
Length:
1326
CDS:
150..992

Additional Resources:

NCBI RefSeq record:
NM_001258211.1
NBCI Gene record:
FBXO16 (157574)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001258211.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000098962 CCAAGCTTCCAAGGGTGTTAT pLKO.1 382 CDS 100% 13.200 18.480 N Fbxo16 n/a
2 TRCN0000422503 TGTAATCGCTGACGTTCAACT pLKO_005 641 CDS 100% 4.950 6.930 N FBXO16 n/a
3 TRCN0000147114 CGTTCAACTAGTTACAAGCAA pLKO.1 653 CDS 100% 0.000 0.000 N FBXO16 n/a
4 TRCN0000146285 CCCAAAGGATGGATTTGTAAT pLKO.1 626 CDS 100% 13.200 9.240 N FBXO16 n/a
5 TRCN0000148209 GATCTGGAAGAAGCACTATAT pLKO.1 563 CDS 100% 13.200 9.240 N FBXO16 n/a
6 TRCN0000428673 ACTATATTCAAATGGTGAAAG pLKO_005 577 CDS 100% 10.800 7.560 N FBXO16 n/a
7 TRCN0000417042 CAAGCTTCCAAGGGTGTTATC pLKO_005 383 CDS 100% 10.800 7.560 N FBXO16 n/a
8 TRCN0000149870 CCGACAGTCACATGATAAGAA pLKO.1 890 CDS 100% 5.625 3.938 N FBXO16 n/a
9 TRCN0000412640 CTAAACCATCAGCTATTGAAT pLKO_005 222 CDS 100% 5.625 3.938 N FBXO16 n/a
10 TRCN0000147734 GACTGAACATGGAAAGACTTT pLKO.1 1153 3UTR 100% 4.950 3.465 N FBXO16 n/a
11 TRCN0000426989 AGGTTCCAGAGCCAAAGTGGA pLKO_005 1134 3UTR 100% 2.640 1.848 N FBXO16 n/a
12 TRCN0000425865 ATGACTCATCCAGGTTCCAGA pLKO_005 1123 3UTR 100% 2.640 1.848 N FBXO16 n/a
13 TRCN0000149379 GATCTTCTGATAAGCACCCAA pLKO.1 772 CDS 100% 2.640 1.848 N FBXO16 n/a
14 TRCN0000149016 GCTGAAATTCTCATGCAGCAT pLKO.1 1076 3UTR 100% 2.640 1.848 N FBXO16 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001258211.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09713 pDONR223 100% 95.7% 95.8% None 97_98ins36;558T>C n/a
2 ccsbBroad304_09713 pLX_304 0% 95.7% 95.8% V5 97_98ins36;558T>C n/a
3 TRCN0000477666 GCCTTCTCTTAGATCAAATCATTC pLX_317 41% 95.7% 95.8% V5 97_98ins36;558T>C n/a
Download CSV