Transcript: Human NM_172366.4

Homo sapiens F-box protein 16 (FBXO16), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
FBXO16 (157574)
Length:
1254
CDS:
61..939

Additional Resources:

NCBI RefSeq record:
NM_172366.4
NBCI Gene record:
FBXO16 (157574)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_172366.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000098962 CCAAGCTTCCAAGGGTGTTAT pLKO.1 329 CDS 100% 13.200 18.480 N Fbxo16 n/a
2 TRCN0000149483 GCTATTGAATGACCGGGTATT pLKO.1 144 CDS 100% 10.800 15.120 N FBXO16 n/a
3 TRCN0000422503 TGTAATCGCTGACGTTCAACT pLKO_005 588 CDS 100% 4.950 6.930 N FBXO16 n/a
4 TRCN0000147114 CGTTCAACTAGTTACAAGCAA pLKO.1 600 CDS 100% 0.000 0.000 N FBXO16 n/a
5 TRCN0000146285 CCCAAAGGATGGATTTGTAAT pLKO.1 573 CDS 100% 13.200 9.240 N FBXO16 n/a
6 TRCN0000148209 GATCTGGAAGAAGCACTATAT pLKO.1 510 CDS 100% 13.200 9.240 N FBXO16 n/a
7 TRCN0000428673 ACTATATTCAAATGGTGAAAG pLKO_005 524 CDS 100% 10.800 7.560 N FBXO16 n/a
8 TRCN0000417042 CAAGCTTCCAAGGGTGTTATC pLKO_005 330 CDS 100% 10.800 7.560 N FBXO16 n/a
9 TRCN0000428862 CCCTGCTTGGCAAATGGTTTG pLKO_005 179 CDS 100% 6.000 4.200 N FBXO16 n/a
10 TRCN0000149870 CCGACAGTCACATGATAAGAA pLKO.1 837 CDS 100% 5.625 3.938 N FBXO16 n/a
11 TRCN0000412640 CTAAACCATCAGCTATTGAAT pLKO_005 133 CDS 100% 5.625 3.938 N FBXO16 n/a
12 TRCN0000147734 GACTGAACATGGAAAGACTTT pLKO.1 1100 3UTR 100% 4.950 3.465 N FBXO16 n/a
13 TRCN0000426989 AGGTTCCAGAGCCAAAGTGGA pLKO_005 1081 3UTR 100% 2.640 1.848 N FBXO16 n/a
14 TRCN0000425865 ATGACTCATCCAGGTTCCAGA pLKO_005 1070 3UTR 100% 2.640 1.848 N FBXO16 n/a
15 TRCN0000149379 GATCTTCTGATAAGCACCCAA pLKO.1 719 CDS 100% 2.640 1.848 N FBXO16 n/a
16 TRCN0000149016 GCTGAAATTCTCATGCAGCAT pLKO.1 1023 3UTR 100% 2.640 1.848 N FBXO16 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_172366.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09713 pDONR223 100% 99.8% 100% None 594T>C n/a
2 ccsbBroad304_09713 pLX_304 0% 99.8% 100% V5 594T>C n/a
3 TRCN0000477666 GCCTTCTCTTAGATCAAATCATTC pLX_317 41% 99.8% 100% V5 594T>C n/a
Download CSV