Transcript: Mouse XM_006519231.3

PREDICTED: Mus musculus F-box protein 16 (Fbxo16), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Fbxo16 (50759)
Length:
4002
CDS:
705..1574

Additional Resources:

NCBI RefSeq record:
XM_006519231.3
NBCI Gene record:
Fbxo16 (50759)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006519231.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000098961 CACTGACATCATCCGCTTTAA pLKO.1 1382 CDS 100% 13.200 9.240 N Fbxo16 n/a
2 TRCN0000098962 CCAAGCTTCCAAGGGTGTTAT pLKO.1 973 CDS 100% 13.200 9.240 N Fbxo16 n/a
3 TRCN0000098964 ACTGCCGATGTTCAGCCAATT pLKO.1 1236 CDS 100% 10.800 7.560 N Fbxo16 n/a
4 TRCN0000417042 CAAGCTTCCAAGGGTGTTATC pLKO_005 974 CDS 100% 10.800 7.560 N FBXO16 n/a
5 TRCN0000098960 CCACTGACATCATCCGCTTTA pLKO.1 1381 CDS 100% 10.800 7.560 N Fbxo16 n/a
6 TRCN0000098963 ACCAGGTATTTGAAGAACGAA pLKO.1 799 CDS 100% 3.000 2.100 N Fbxo16 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006519231.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09713 pDONR223 100% 82% 84.9% None (many diffs) n/a
2 ccsbBroad304_09713 pLX_304 0% 82% 84.9% V5 (many diffs) n/a
3 TRCN0000477666 GCCTTCTCTTAGATCAAATCATTC pLX_317 41% 82% 84.9% V5 (many diffs) n/a
Download CSV