Construct: ORF TRCN0000477913
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF005475.1_s317c1
- Derived from:
- ccsbBroadEn_14249
- DNA Barcode:
- CTCCTATTAAAATTATTTCGGAGT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- NT5DC2 (64943)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000477913
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 64943 | NT5DC2 | 5'-nucleotidase domain cont... | NM_022908.3 | 88% | 87.5% | (many diffs) |
| 2 | human | 64943 | NT5DC2 | 5'-nucleotidase domain cont... | XM_005265406.2 | 84.3% | 84.5% | (many diffs) |
| 3 | human | 64943 | NT5DC2 | 5'-nucleotidase domain cont... | XM_006713305.2 | 84.3% | 84.5% | (many diffs) |
| 4 | human | 64943 | NT5DC2 | 5'-nucleotidase domain cont... | NM_001134231.2 | 82.5% | 82.5% | (many diffs) |
| 5 | human | 64943 | NT5DC2 | 5'-nucleotidase domain cont... | XM_024453719.1 | 79.7% | 79.9% | (many diffs) |
| 6 | human | 64943 | NT5DC2 | 5'-nucleotidase domain cont... | XM_006713303.3 | 75.3% | 75.4% | (many diffs) |
| 7 | mouse | 70021 | Nt5dc2 | 5'-nucleotidase domain cont... | NM_027289.1 | 76.1% | 82.8% | (many diffs) |
| 8 | mouse | 70021 | Nt5dc2 | 5'-nucleotidase domain cont... | XM_006519507.2 | 74.8% | 81.1% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1449
- ORF length:
- 1383
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgcg gagactggtg cacgacctcc tgccccccga ggtctgcagt ctcctgaacc 121 cagcagccat ctacgccaac aacgagatca gcctgcgtga cgttgaggtc tacggctttg 181 actacgacta caccctggac cagtatgcag acgcactgca ccccgagatc ttcagtaccg 241 cccgtgacat cctgatcgag cactacaaga gccttctgat gaagattgac gccttccact 301 acgtgcagct ggggacagcc tacaggggcc tccagcctgt gccagacgag gaggtgattg 361 agctgtatgg gggtacccag cacatcccac tataccagat gagtggcttc tatggcaagg 421 gtccctccat taagcagttc atggacatct tctcgctacc ggagatggct ctgctgtcct 481 gtgtggtgga ctactttctg ggccacagcc tggagtttga ccaagcacat ctctacaagg 541 acgtgacgga cgccatccga gacgtgcatg tgaagggcct catgtaccag tggatcgagc 601 aggacatgga gaagtacatc ctgagagggg atgagacgtt tgctgtcctg agccgcctgg 661 tggcccatgg gaagcagctg ttcctcatca ccaacagtcc tttcagcttc gtagacaagg 721 ggatgcggca catggtgggt cccgattggc gccagctctt cgatgtggtc attgtccagg 781 cagacaagcc cagcttcttc actgaccggc gcaagccttt cagaaaactc gatgagaagg 841 gctcacttca gtgggaccgg atcacccgct tggaaaaggg caagatctat cggcagggaa 901 acctgtttga cttcttgcgc ttgacggaat ggcgtggccc ccgcgtgctc tacttcgggg 961 accacctcta tagtgatctg gcggatctca tgctgcggca cggctggcgc acaggcgcca 1021 tcatccccga gctggagcgt gagatccgca tcatcaacac ggagcagtac atgcactcgc 1081 tgacgtggca acaggcgctc acggggctgc tggagcgcat gcagacctat caggacgcGG 1141 AGTCGAGGCA GGTGCTGGCT GCCTGGATGA AAGAGCGGCA GGAGCTGAGG TGCATCACCA 1201 AGGCCCTGTT CAATGCGCAG TTCGGCAGCA TCTTCCGCAC CTTCCACAAC CCCACCTACT 1261 TCTCAAGGCG CCTCGTGCGC TTCTCTGACC TCTACATGGC CTCCCTCAGC TGCCTGCTCA 1321 ACTACCGCGT GGACTTCACC TTCTACCCAC GCCGTACGCC GCTGCAGCAC GAGGCACCCC 1381 TCTGGATGGA CCAGCTCTGC ACCGGCTGCA TGAAGACCCC CTTCCTTGGT GACATGGCCC 1441 ACATCCGCTG CACAACTTTC TTGTACAAAG TGGTTGATAT CGGTAAGCCT ATCCCTAACC 1501 CTCTCCTCGG TCTCGATTCT ACGTAGTAAT GAACTAGTCC GTAACTTGAA AGTATTTCGA 1561 TTTCTTGGCT TTATATATCT TGTGGAAAGG ACGACTCCTA TTAAAATTAT TTCGGAGTAC 1621 GCGTTAAGTC gacaatcaac ctctggatta caaaatttgt gaaagatt