Transcript: Human XM_006713303.3

PREDICTED: Homo sapiens 5'-nucleotidase domain containing 2 (NT5DC2), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NT5DC2 (64943)
Length:
1677
CDS:
35..1588

Additional Resources:

NCBI RefSeq record:
XM_006713303.3
NBCI Gene record:
NT5DC2 (64943)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006713303.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000350758 GTGGCCTCCACTATGACATTC pLKO_005 501 CDS 100% 10.800 15.120 N NT5DC2 n/a
2 TRCN0000127660 CAAGATCTATCGGCAGGGAAA pLKO.1 1138 CDS 100% 4.050 5.670 N NT5DC2 n/a
3 TRCN0000127779 GACTTCTTACGCTTGACGGAA pLKO.1 1166 CDS 100% 2.640 3.696 N NT5DC2 n/a
4 TRCN0000323389 CAGAAGGGATTCGGAAGTATG pLKO_005 456 CDS 100% 10.800 8.640 N NT5DC2 n/a
5 TRCN0000323390 TGGCAAGGGTCCCTCCATTAA pLKO_005 670 CDS 100% 13.200 9.240 N NT5DC2 n/a
6 TRCN0000251346 CCTGTGTGGTGGACTACTTTC pLKO_005 735 CDS 100% 10.800 7.560 N Nt5dc2 n/a
7 TRCN0000130674 CCAGAAGGGATTCGGAAGTAT pLKO.1 455 CDS 100% 5.625 3.938 N NT5DC2 n/a
8 TRCN0000127536 CATCCTGATCGAGCACTACAA pLKO.1 430 CDS 100% 4.950 3.465 N NT5DC2 n/a
9 TRCN0000130367 GAAGAGCCTTCTGATGAAGAT pLKO.1 523 CDS 100% 4.950 3.465 N NT5DC2 n/a
10 TRCN0000323338 GAAGAGCCTTCTGATGAAGAT pLKO_005 523 CDS 100% 4.950 3.465 N NT5DC2 n/a
11 TRCN0000127982 GCAGGGAAACCTGTTTGACTT pLKO.1 1150 CDS 100% 4.950 3.465 N NT5DC2 n/a
12 TRCN0000127794 GATGAGTGGCTTCTATGGCAA pLKO.1 655 CDS 100% 2.640 1.848 N NT5DC2 n/a
13 TRCN0000323391 TACCCAGCACATCCCACTATA pLKO_005 631 CDS 100% 0.000 0.000 N NT5DC2 n/a
14 TRCN0000127535 CATCATCAACACGGAGCAGTA pLKO.1 1306 CDS 100% 4.050 2.430 N NT5DC2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006713303.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14249 pDONR223 100% 75.3% 75.4% None (many diffs) n/a
2 ccsbBroad304_14249 pLX_304 0% 75.3% 75.4% V5 (many diffs) n/a
3 TRCN0000477913 CTCCTATTAAAATTATTTCGGAGT pLX_317 22.8% 75.3% 75.4% V5 (many diffs) n/a
4 TRCN0000479648 GACATCTCACACGCCATAGCCTTA pLX_317 18.8% 75.3% 75.4% V5 (many diffs) n/a
Download CSV