Transcript: Mouse XM_006519507.2

PREDICTED: Mus musculus 5'-nucleotidase domain containing 2 (Nt5dc2), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Nt5dc2 (70021)
Length:
2095
CDS:
352..2013

Additional Resources:

NCBI RefSeq record:
XM_006519507.2
NBCI Gene record:
Nt5dc2 (70021)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006519507.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000251347 TAGAGAAGGGCAAGATCTATC pLKO_005 1433 CDS 100% 10.800 15.120 N Nt5dc2 n/a
2 TRCN0000251344 TATCCGCGATGTGCATGTAAA pLKO_005 1116 CDS 100% 13.200 9.240 N Nt5dc2 n/a
3 TRCN0000251343 TACTTCGGTGACCACCTTTAC pLKO_005 1513 CDS 100% 10.800 7.560 N Nt5dc2 n/a
4 TRCN0000251345 TGCATCACAAAGGCCCTATTC pLKO_005 1753 CDS 100% 10.800 7.560 N Nt5dc2 n/a
5 TRCN0000127660 CAAGATCTATCGGCAGGGAAA pLKO.1 1443 CDS 100% 4.050 2.835 N NT5DC2 n/a
6 TRCN0000251346 CCTGTGTGGTGGACTACTTTC pLKO_005 1040 CDS 100% 10.800 6.480 N Nt5dc2 n/a
7 TRCN0000127535 CATCATCAACACGGAGCAGTA pLKO.1 1611 CDS 100% 4.050 2.430 N NT5DC2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006519507.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14249 pDONR223 100% 74.8% 81.1% None (many diffs) n/a
2 ccsbBroad304_14249 pLX_304 0% 74.8% 81.1% V5 (many diffs) n/a
3 TRCN0000477913 CTCCTATTAAAATTATTTCGGAGT pLX_317 22.8% 74.8% 81.1% V5 (many diffs) n/a
4 TRCN0000479648 GACATCTCACACGCCATAGCCTTA pLX_317 18.8% 74.8% 81.1% V5 (many diffs) n/a
Download CSV