Construct: ORF TRCN0000477997
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF002169.1_s317c1
- Derived from:
- ccsbBroadEn_07214
- DNA Barcode:
- GCACAAGGTCGTGAATTCAGTTAA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- H3-4 (8290)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000477997
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 8290 | H3-4 | H3.4 histone | NM_003493.2 | 99.7% | 100% | 189C>A |
| 2 | human | 653604 | H3C13 | H3 clustered histone 13 | NM_001123375.2 | 88.4% | 96.3% | (many diffs) |
| 3 | human | 333932 | H3C15 | H3 clustered histone 15 | NM_001005464.2 | 87.9% | 96.3% | (many diffs) |
| 4 | human | 126961 | H3C14 | H3 clustered histone 14 | NM_021059.2 | 87.9% | 96.3% | (many diffs) |
| 5 | human | 440686 | H3-2 | H3.2 histone (putative) | NM_001355409.3 | 87.5% | 94.1% | (many diffs) |
| 6 | human | 440686 | H3-2 | H3.2 histone (putative) | NM_001372105.1 | 87.5% | 94.1% | (many diffs) |
| 7 | human | 8354 | H3C11 | H3 clustered histone 11 | NM_003533.2 | 86.5% | 97% | (many diffs) |
| 8 | human | 8351 | H3C4 | H3 clustered histone 4 | NM_003530.4 | 86.2% | 97% | (many diffs) |
| 9 | human | 8357 | H3C10 | H3 clustered histone 10 | NM_003536.2 | 86% | 97% | (many diffs) |
| 10 | human | 8355 | H3C8 | H3 clustered histone 8 | NM_003534.2 | 85.2% | 97% | (many diffs) |
| 11 | human | 8968 | H3C7 | H3 clustered histone 7 | NM_021018.2 | 84.5% | 97% | (many diffs) |
| 12 | human | 8350 | H3C1 | H3 clustered histone 1 | NM_003529.2 | 84.3% | 97% | (many diffs) |
| 13 | human | 8353 | H3C6 | H3 clustered histone 6 | NM_003532.2 | 84% | 97% | (many diffs) |
| 14 | human | 8356 | H3C12 | H3 clustered histone 12 | NM_003535.2 | 83.6% | 97% | (many diffs) |
| 15 | human | 8352 | H3C3 | H3 clustered histone 3 | NM_003531.2 | 81.9% | 97% | (many diffs) |
| 16 | human | 8358 | H3C2 | H3 clustered histone 2 | NM_003537.3 | 80.3% | 97% | (many diffs) |
| 17 | human | 3021 | H3-3B | H3.3 histone B | NM_005324.5 | 78.8% | 93.3% | (many diffs) |
| 18 | human | 440093 | H3-5 | H3.5 histone | NM_001013699.3 | 77.7% | 90.4% | (many diffs) |
| 19 | human | 3020 | H3-3A | H3.3 histone A | NM_002107.6 | 77.3% | 93.3% | (many diffs) |
| 20 | human | 106479023 | H3P4 | H3 histone pseudogene 4 | NR_160943.1 | 33.3% | (many diffs) | |
| 21 | human | 106479023 | H3P4 | H3 histone pseudogene 4 | NR_160941.1 | 18.2% | (many diffs) | |
| 22 | human | 106479023 | H3P4 | H3 histone pseudogene 4 | NR_160940.1 | 16.3% | (many diffs) | |
| 23 | mouse | 97114 | Hist2h3c2 | histone cluster 2, H3c2 | NM_054045.4 | 89.2% | 96.3% | (many diffs) |
| 24 | mouse | 15077 | Hist2h3c1 | histone cluster 2, H3c1 | NM_178216.3 | 89.2% | 96.3% | (many diffs) |
| 25 | mouse | 319154 | Hist2h3b | histone cluster 2, H3b | NM_178215.2 | 88.9% | 96.3% | (many diffs) |
| 26 | mouse | 260423 | Hist1h3f | histone cluster 1, H3f | NM_013548.4 | 88.4% | 96.3% | (many diffs) |
| 27 | mouse | 319151 | Hist1h3e | histone cluster 1, H3e | NM_178205.2 | 88.4% | 96.3% | (many diffs) |
| 28 | mouse | 319152 | Hist1h3h | histone cluster 1, H3h | NM_178206.2 | 88.2% | 97% | (many diffs) |
| 29 | mouse | 97908 | Hist1h3g | histone cluster 1, H3g | NM_145073.2 | 87.9% | 97% | (many diffs) |
| 30 | mouse | 319149 | Hist1h3d | histone cluster 1, H3d | NM_178204.2 | 87.9% | 96.3% | (many diffs) |
| 31 | mouse | 319150 | Hist1h3b | histone cluster 1, H3b | NM_178203.2 | 87.7% | 96.3% | (many diffs) |
| 32 | mouse | 360198 | Hist1h3a | histone cluster 1, H3a | NM_013550.5 | 87.5% | 97% | (many diffs) |
| 33 | mouse | 319153 | Hist1h3i | histone cluster 1, H3i | NM_178207.2 | 87.5% | 97% | (many diffs) |
| 34 | mouse | 319148 | Hist1h3c | histone cluster 1, H3c | NM_175653.2 | 87.5% | 96.3% | (many diffs) |
| 35 | mouse | 382523 | Gm12260 | predicted gene 12260 | NM_001318003.2 | 87% | 97.7% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 477
- ORF length:
- 408
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat ggcccgaacc aagcagactg cgcgcaagtc aacgggtggc aaggcgccgc 121 gcaagcagct ggccaccaag gtggctcgca agagcgcacc tgccactggc ggcgtgaaga 181 agccgcaccg ctaccggccc ggcacggtgg cgcttcgcga gatccgccgc taccagaagt 241 ccactgagct gctaatacgc aagttgccct tccagcggct gatgcgcgag atcgctcagg 301 actttaagac cgacctgcgc ttccagagct cggccgtgat GGCGCTGCAG GAGGCGTGCG 361 AGTCTTACCT GGTGGGGCTG TTTGAGGACA CCAACCTGTG TGTCATCCAT GCCAAACGGG 421 TCACCATCAT GCCTAAGGAC ATCCAGCTGG CACGCCGTAT CCGCGGGGAG CGGGCCTTGC 481 CAACTTTCTT GTACAAAGTG GTTGATATCG GTAAGCCTAT CCCTAACCCT CTCCTCGGTC 541 TCGATTCTAC GTAGTAATGA ACTAGTCCGT AACTTGAAAG TATTTCGATT TCTTGGCTTT 601 ATATATCTTG TGGAAAGGAC GAGCACAAGG TCGTGAATTC AGTTAAACGC GTTAAGTCga 661 caatcaacct ctggattaca aaatttgtga aagatt