Transcript: Human NM_001013699.3

Homo sapiens H3.5 histone (H3-5), mRNA.

Source:
NCBI, updated 2019-07-25
Taxon:
Homo sapiens (human)
Gene:
H3-5 (440093)
Length:
1114
CDS:
133..540

Additional Resources:

NCBI RefSeq record:
NM_001013699.3
NBCI Gene record:
H3-5 (440093)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001013699.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000115693 GCAGGATTTCAACACTGACCT pLKO.1 357 CDS 100% 2.640 1.848 N H3-5 n/a
2 TRCN0000115695 TGGGTCTGTTGGAAGATACTA pLKO.1 434 CDS 100% 5.625 3.375 N H3-5 n/a
3 TRCN0000115692 CTGTGATAGAATGTAGGCTTT pLKO.1 931 3UTR 100% 4.050 2.430 N H3-5 n/a
4 TRCN0000115694 GCCACGAAAGCTGCCAGGAAA pLKO.1 196 CDS 100% 1.650 0.990 N H3-5 n/a
5 TRCN0000296064 GACTTGTTGGGTAGCTATTAA pLKO_005 802 3UTR 100% 15.000 7.500 Y H3-3B n/a
6 TRCN0000062389 CGCTAAGAGAGTCACCATCAT pLKO.1 471 CDS 100% 4.950 2.475 Y H3-3B n/a
7 TRCN0000298829 CGCTAAGAGAGTCACCATCAT pLKO_005 471 CDS 100% 4.950 2.475 Y H3-3B n/a
8 TRCN0000062390 GCTTCGAGAGATTCGTCGTTA pLKO.1 273 CDS 100% 4.950 2.475 Y H3-3B n/a
9 TRCN0000298830 GCTTCGAGAGATTCGTCGTTA pLKO_005 273 CDS 100% 4.950 2.475 Y H3-3B n/a
10 TRCN0000062391 CATGCCCAAAGACATCCAGTT pLKO.1 489 CDS 100% 4.050 2.025 Y H3-3B n/a
11 TRCN0000298828 CATGCCCAAAGACATCCAGTT pLKO_005 489 CDS 100% 4.050 2.025 Y H3-3B n/a
12 TRCN0000062392 CCACGCTAAGAGAGTCACCAT pLKO.1 468 CDS 100% 2.640 1.320 Y H3-3B n/a
13 TRCN0000115696 CCAGAGGTTGGTGAGGGAGAT pLKO.1 333 CDS 100% 1.350 0.675 Y H3-5 n/a
14 TRCN0000242125 AGAAGTCGACCGAGCTGCTGA pLKO_005 296 CDS 100% 0.880 0.440 Y Hist1h3d n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001013699.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10159 pDONR223 100% 99.7% 99.2% None 263C>T n/a
2 ccsbBroad304_10159 pLX_304 0% 99.7% 99.2% V5 263C>T n/a
3 ccsbBroadEn_00719 pDONR223 100% 96.5% 95.5% None (many diffs) n/a
4 ccsbBroad304_00719 pLX_304 0% 96.5% 95.5% V5 (many diffs) n/a
5 TRCN0000473475 ACAACCTAGAGAAGGGCCGCGTGA pLX_317 92% 96.5% 95.5% V5 (many diffs) n/a
6 ccsbBroadEn_04820 pDONR223 100% 79.7% 94.1% None (many diffs) n/a
7 ccsbBroad304_04820 pLX_304 0% 79.7% 94.1% V5 (many diffs) n/a
8 TRCN0000470519 GCCGATTGAGCTCTTAAAAGGAAC pLX_317 100% 79.7% 94.1% V5 (many diffs) n/a
9 ccsbBroadEn_01907 pDONR223 100% 79.1% 93.3% None (many diffs) n/a
10 ccsbBroad304_01907 pLX_304 0% 79.1% 93.3% V5 (many diffs) n/a
11 TRCN0000469614 CTGCCGATCGGACTGCTGGCTACG pLX_317 100% 79.1% 93.3% V5 (many diffs) n/a
12 ccsbBroadEn_07332 pDONR223 100% 78.4% 93.3% None (many diffs) n/a
13 ccsbBroad304_07332 pLX_304 0% 78.4% 93.3% V5 (many diffs) n/a
14 TRCN0000475169 CTGATGTGCTCCCTCCTTGCCCTC pLX_317 57.4% 78.4% 93.3% V5 (many diffs) n/a
15 ccsbBroadEn_02054 pDONR223 100% 78.2% 93.3% None (many diffs) n/a
16 ccsbBroad304_02054 pLX_304 0% 78.2% 93.3% V5 (many diffs) n/a
17 TRCN0000474049 ACGAGTAGAGTAGCATGTAAGCCT pLX_317 92% 78.2% 93.3% V5 (many diffs) n/a
18 ccsbBroadEn_07333 pDONR223 100% 78.2% 93.3% None (many diffs) n/a
19 ccsbBroad304_07333 pLX_304 0% 78.2% 93.3% V5 (many diffs) n/a
20 TRCN0000468120 GCAGCACCCCACCATAATCTTTGA pLX_317 96% 78.2% 93.3% V5 (many diffs) n/a
21 ccsbBroadEn_07214 pDONR223 100% 77.7% 90.4% None (many diffs) n/a
22 ccsbBroad304_07214 pLX_304 0% 77.7% 90.4% V5 (many diffs) n/a
23 TRCN0000477997 GCACAAGGTCGTGAATTCAGTTAA pLX_317 34.1% 77.7% 90.4% V5 (many diffs) n/a
24 ccsbBroadEn_01904 pDONR223 100% 77.5% 93.3% None (many diffs) n/a
25 ccsbBroad304_01904 pLX_304 97.8% 77.5% 93.3% V5 (many diffs) n/a
26 TRCN0000465966 TGCACCAAATCGTATAGACTTAAT pLX_317 74.7% 77.5% 93.3% V5 (many diffs) n/a
27 ccsbBroadEn_01908 pDONR223 100% 77.4% 93.3% None (many diffs) n/a
28 ccsbBroad304_01908 pLX_304 0% 77.4% 93.3% V5 (many diffs) n/a
29 TRCN0000467485 CTCAATTAACCTTCGGAGAAGTTC pLX_317 89.4% 77.4% 93.3% V5 (many diffs) n/a
30 ccsbBroadEn_01905 pDONR223 100% 76.9% 93.3% None (many diffs) n/a
31 ccsbBroad304_01905 pLX_304 0% 76.9% 93.3% V5 (many diffs) n/a
32 TRCN0000469866 TCGCGAGAACCCACGTCATTTGGC pLX_317 98.6% 76.9% 93.3% V5 (many diffs) n/a
33 ccsbBroadEn_07225 pDONR223 100% 76.9% 92.6% None (many diffs) n/a
34 ccsbBroad304_07225 pLX_304 0% 76.9% 92.6% V5 (many diffs) n/a
35 ccsbBroadEn_07226 pDONR223 100% 76.9% 93.3% None (many diffs) n/a
36 ccsbBroad304_07226 pLX_304 0% 76.9% 93.3% V5 (many diffs) n/a
37 TRCN0000465999 CATGGCGATGGACTCTTGTAAGTC pLX_317 82.1% 76.9% 93.3% V5 (many diffs) n/a
38 ccsbBroadEn_01906 pDONR223 100% 76.4% 93.3% None (many diffs) n/a
39 ccsbBroad304_01906 pLX_304 0% 76.4% 93.3% V5 (many diffs) n/a
40 TRCN0000469791 ACACCATCTCGTTTATTTCAGCTA pLX_317 77.1% 76.4% 93.3% V5 (many diffs) n/a
41 ccsbBroadEn_01909 pDONR223 100% 76.2% 93.3% None (many diffs) n/a
42 ccsbBroad304_01909 pLX_304 97.2% 76.2% 93.3% V5 (many diffs) n/a
43 TRCN0000479054 GCGCGGCCAACGTGTTATAATTCG pLX_317 93.7% 76.2% 93.3% V5 (many diffs) n/a
Download CSV