Transcript: Human NR_160943.1

Homo sapiens H3 histone pseudogene 4 (H3P4), transcript variant 3, non-coding RNA.

Source:
NCBI, updated 2019-07-25
Taxon:
Homo sapiens (human)
Gene:
H3P4 (106479023)
Length:
1072
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_160943.1
NBCI Gene record:
H3P4 (106479023)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_160943.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000243828 CGAGATCGCGCAGGACTTTAA pLKO_005 234 3UTR 100% 13.200 6.600 Y H3C13 n/a
2 TRCN0000281408 GAGATCGCGCAGGACTTTAAG pLKO_005 235 3UTR 100% 13.200 6.600 Y H3C15 n/a
3 TRCN0000243829 AGGAAGCAGCTGGCTACCAAA pLKO_005 68 3UTR 100% 4.950 2.475 Y H3C13 n/a
4 TRCN0000106757 GCGAGATCGCGCAGGACTTTA pLKO.1 233 3UTR 100% 4.400 2.200 Y H3C14 n/a
5 TRCN0000238060 ACCATCATGCCCAAGGACATC pLKO_005 376 3UTR 100% 4.050 2.025 Y Hist1h3f n/a
6 TRCN0000092885 CATGCCCAAGGACATCCAGTT pLKO.1 381 3UTR 100% 4.050 2.025 Y Hist2h3c2 n/a
7 TRCN0000243830 CATGCCCAAGGACATCCAGTT pLKO_005 381 3UTR 100% 4.050 2.025 Y H3C13 n/a
8 TRCN0000265659 TTTAAGACGGACCTGCGCTTC pLKO_005 250 3UTR 100% 2.250 1.125 Y H3C15 n/a
9 TRCN0000243826 AGGACTTTAAGACGGACCTGC pLKO_005 245 3UTR 100% 2.160 1.080 Y H3C13 n/a
10 TRCN0000243827 CTACCAGAAGTCTACGGAGCT pLKO_005 177 3UTR 100% 2.160 1.080 Y H3C13 n/a
11 TRCN0000106755 GCAGGACTTTAAGACGGACCT pLKO.1 243 3UTR 100% 2.160 1.080 Y H3C14 n/a
12 TRCN0000106758 AGACACGAACCTGTGCGCCAT pLKO.1 339 3UTR 100% 0.720 0.360 Y H3C14 n/a
13 TRCN0000255652 CCAGCGGCTGGTACGCGAGAT pLKO_005 219 3UTR 100% 0.000 0.000 Y H3C15 n/a
14 TRCN0000106756 CTGCCCTTCCAGCGGCTGGTA pLKO.1 211 3UTR 100% 0.000 0.000 Y H3C14 n/a
15 TRCN0000282161 GTGAAGAAGCCGCACCGCTAC pLKO_005 122 3UTR 100% 0.000 0.000 Y Hist2h3b n/a
16 TRCN0000282160 GCGAGATCGCGCAGGACTTCA pLKO_005 233 3UTR 100% 0.000 0.000 Y Hist2h3b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_160943.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04820 pDONR223 100% 36.4% None (many diffs) n/a
2 ccsbBroad304_04820 pLX_304 0% 36.4% V5 (many diffs) n/a
3 TRCN0000470519 GCCGATTGAGCTCTTAAAAGGAAC pLX_317 100% 36.4% V5 (many diffs) n/a
4 ccsbBroadEn_07214 pDONR223 100% 33.3% None (many diffs) n/a
5 ccsbBroad304_07214 pLX_304 0% 33.3% V5 (many diffs) n/a
6 TRCN0000477997 GCACAAGGTCGTGAATTCAGTTAA pLX_317 34.1% 33.3% V5 (many diffs) n/a
7 ccsbBroadEn_13992 pDONR223 100% 32.6% None (many diffs) n/a
8 ccsbBroad304_13992 pLX_304 0% 32.6% V5 (not translated due to prior stop codon) (many diffs) n/a
9 TRCN0000474854 TCCGGCCCACTCTACGTTTGCATT pLX_317 100% 32.6% V5 (not translated due to prior stop codon) (many diffs) n/a
10 ccsbBroadEn_01908 pDONR223 100% 32.6% None (many diffs) n/a
11 ccsbBroad304_01908 pLX_304 0% 32.6% V5 (many diffs) n/a
12 TRCN0000467485 CTCAATTAACCTTCGGAGAAGTTC pLX_317 89.4% 32.6% V5 (many diffs) n/a
Download CSV