Transcript: Human NM_003535.2

Homo sapiens H3 clustered histone 12 (H3C12), mRNA.

Source:
NCBI, updated 2019-07-25
Taxon:
Homo sapiens (human)
Gene:
H3C12 (8356)
Length:
478
CDS:
1..411

Additional Resources:

NCBI RefSeq record:
NM_003535.2
NBCI Gene record:
H3C12 (8356)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_003535.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000106927 TCCAGCGACTGGCGGTGTGAA pLKO.1 90 CDS 100% 0.000 0.000 N H3C12 n/a
2 TRCN0000426158 CCTATCTGGTGGGTCTCTTTG pLKO_005 296 CDS 100% 10.800 7.560 N H3C12 n/a
3 TRCN0000106925 CATCCGCAAACTGCCATTTCA pLKO.1 186 CDS 100% 5.625 3.938 N H3C12 n/a
4 TRCN0000106929 TGAGCTGCTCATCCGCAAACT pLKO.1 177 CDS 100% 4.950 3.465 N H3C12 n/a
5 TRCN0000106926 CCTTGCGTGAGATCCGCCGTT pLKO.1 143 CDS 100% 0.000 0.000 N H3C12 n/a
6 TRCN0000106928 GACACCAACCTCTGTGCTATT pLKO.1 319 CDS 100% 10.800 6.480 N H3C12 n/a
7 TRCN0000425118 TGCGAGAAATCGCGCAGGATT pLKO_005 215 CDS 100% 4.950 2.970 N H3C12 n/a
8 TRCN0000424557 CGTTATCAGAAGTCGACTGAG pLKO_005 160 CDS 100% 4.050 2.430 N H3C12 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_003535.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07226 pDONR223 100% 85% 100% None (many diffs) n/a
2 ccsbBroad304_07226 pLX_304 0% 85% 100% V5 (many diffs) n/a
3 TRCN0000465999 CATGGCGATGGACTCTTGTAAGTC pLX_317 82.1% 85% 100% V5 (many diffs) n/a
4 ccsbBroadEn_01908 pDONR223 100% 85% 100% None (many diffs) n/a
5 ccsbBroad304_01908 pLX_304 0% 85% 100% V5 (many diffs) n/a
6 TRCN0000467485 CTCAATTAACCTTCGGAGAAGTTC pLX_317 89.4% 85% 100% V5 (many diffs) n/a
7 ccsbBroadEn_02054 pDONR223 100% 84.8% 100% None (many diffs) n/a
8 ccsbBroad304_02054 pLX_304 0% 84.8% 100% V5 (many diffs) n/a
9 TRCN0000474049 ACGAGTAGAGTAGCATGTAAGCCT pLX_317 92% 84.8% 100% V5 (many diffs) n/a
10 ccsbBroadEn_07225 pDONR223 100% 84.8% 99.2% None (many diffs) n/a
11 ccsbBroad304_07225 pLX_304 0% 84.8% 99.2% V5 (many diffs) n/a
12 ccsbBroadEn_07333 pDONR223 100% 84.8% 100% None (many diffs) n/a
13 ccsbBroad304_07333 pLX_304 0% 84.8% 100% V5 (many diffs) n/a
14 TRCN0000468120 GCAGCACCCCACCATAATCTTTGA pLX_317 96% 84.8% 100% V5 (many diffs) n/a
15 ccsbBroadEn_04820 pDONR223 100% 84.5% 99.2% None (many diffs) n/a
16 ccsbBroad304_04820 pLX_304 0% 84.5% 99.2% V5 (many diffs) n/a
17 TRCN0000470519 GCCGATTGAGCTCTTAAAAGGAAC pLX_317 100% 84.5% 99.2% V5 (many diffs) n/a
18 ccsbBroadEn_07332 pDONR223 100% 84.5% 100% None (many diffs) n/a
19 ccsbBroad304_07332 pLX_304 0% 84.5% 100% V5 (many diffs) n/a
20 TRCN0000475169 CTGATGTGCTCCCTCCTTGCCCTC pLX_317 57.4% 84.5% 100% V5 (many diffs) n/a
21 ccsbBroadEn_01905 pDONR223 100% 84.3% 100% None (many diffs) n/a
22 ccsbBroad304_01905 pLX_304 0% 84.3% 100% V5 (many diffs) n/a
23 TRCN0000469866 TCGCGAGAACCCACGTCATTTGGC pLX_317 98.6% 84.3% 100% V5 (many diffs) n/a
24 ccsbBroadEn_07214 pDONR223 100% 83.6% 97% None (many diffs) n/a
25 ccsbBroad304_07214 pLX_304 0% 83.6% 97% V5 (many diffs) n/a
26 TRCN0000477997 GCACAAGGTCGTGAATTCAGTTAA pLX_317 34.1% 83.6% 97% V5 (many diffs) n/a
27 ccsbBroadEn_01904 pDONR223 100% 83.5% 100% None (many diffs) n/a
28 ccsbBroad304_01904 pLX_304 97.8% 83.5% 100% V5 (many diffs) n/a
29 TRCN0000465966 TGCACCAAATCGTATAGACTTAAT pLX_317 74.7% 83.5% 100% V5 (many diffs) n/a
30 ccsbBroadEn_01906 pDONR223 100% 83% 100% None (many diffs) n/a
31 ccsbBroad304_01906 pLX_304 0% 83% 100% V5 (many diffs) n/a
32 TRCN0000469791 ACACCATCTCGTTTATTTCAGCTA pLX_317 77.1% 83% 100% V5 (many diffs) n/a
33 ccsbBroadEn_01907 pDONR223 100% 82.5% 100% None (many diffs) n/a
34 ccsbBroad304_01907 pLX_304 0% 82.5% 100% V5 (many diffs) n/a
35 TRCN0000469614 CTGCCGATCGGACTGCTGGCTACG pLX_317 100% 82.5% 100% V5 (many diffs) n/a
36 ccsbBroadEn_01909 pDONR223 100% 80.8% 100% None (many diffs) n/a
37 ccsbBroad304_01909 pLX_304 97.2% 80.8% 100% V5 (many diffs) n/a
38 TRCN0000479054 GCGCGGCCAACGTGTTATAATTCG pLX_317 93.7% 80.8% 100% V5 (many diffs) n/a
39 ccsbBroadEn_00719 pDONR223 100% 79.1% 96.3% None (many diffs) n/a
40 ccsbBroad304_00719 pLX_304 0% 79.1% 96.3% V5 (many diffs) n/a
41 TRCN0000473475 ACAACCTAGAGAAGGGCCGCGTGA pLX_317 92% 79.1% 96.3% V5 (many diffs) n/a
Download CSV