Transcript: Human XM_017015828.1

PREDICTED: Homo sapiens V-set and transmembrane domain containing 4 (VSTM4), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
VSTM4 (196740)
Length:
6781
CDS:
690..1430

Additional Resources:

NCBI RefSeq record:
XM_017015828.1
NBCI Gene record:
VSTM4 (196740)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017015828.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000137537 CACGTTCCATAAACCGAAGCT pLKO.1 1256 CDS 100% 2.640 3.696 N VSTM4 n/a
2 TRCN0000138178 CAGAAGGAGAAGCCTGACATT pLKO.1 1200 CDS 100% 4.950 3.465 N VSTM4 n/a
3 TRCN0000135068 CATAAACCGAAGCTGCTGAAA pLKO.1 1263 CDS 100% 4.950 3.465 N VSTM4 n/a
4 TRCN0000138697 GATCCTCTTCGAGGAGAACAA pLKO.1 1403 CDS 100% 4.950 3.465 N VSTM4 n/a
5 TRCN0000137821 GCCACGGAAATGAGAGTCATT pLKO.1 909 CDS 100% 4.950 3.465 N VSTM4 n/a
6 TRCN0000138570 CCCAACTGTAAGATGGCACAT pLKO.1 1853 3UTR 100% 4.050 2.835 N VSTM4 n/a
7 TRCN0000138204 CTTCGAGGAGAACAAGCTGTA pLKO.1 1409 CDS 100% 4.050 2.835 N VSTM4 n/a
8 TRCN0000138853 GTGGTGCAGTACTATGGGAAT pLKO.1 714 CDS 100% 4.050 2.835 N VSTM4 n/a
9 TRCN0000194117 GAGTGAGACATTATTTGGTGA pLKO.1 1099 CDS 100% 2.640 1.848 N Vstm4 n/a
10 TRCN0000136456 CCACGGAAATGAGAGTCATTT pLKO.1 910 CDS 100% 1.320 0.924 N VSTM4 n/a
11 TRCN0000138628 CGGAAATCCAGAGTGAGACAT pLKO.1 1089 CDS 100% 4.950 2.970 N VSTM4 n/a
12 TRCN0000136371 CTTGATGGTGAAGATGACCAA pLKO.1 686 5UTR 100% 2.640 1.584 N VSTM4 n/a
13 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 5679 3UTR 100% 4.950 2.475 Y ERAP2 n/a
14 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 5680 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017015828.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09793 pDONR223 100% 76.5% 76.5% None (many diffs) n/a
2 ccsbBroad304_09793 pLX_304 0% 76.5% 76.5% V5 (many diffs) n/a
3 TRCN0000478079 ACTGGCAACTAAAAAACCGACCGT pLX_317 33.8% 76.5% 76.5% V5 (many diffs) n/a
Download CSV