Construct: ORF TRCN0000478102
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF017308.1_s317c1
- Derived from:
- ccsbBroadEn_00564
- DNA Barcode:
- CGGACTTCGCGTGCGTAGGTCTTC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- FGR (2268)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000478102
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 2268 | FGR | FGR proto-oncogene, Src fam... | NM_001042729.2 | 100% | 100% | |
| 2 | human | 2268 | FGR | FGR proto-oncogene, Src fam... | NM_001042747.1 | 100% | 100% | |
| 3 | human | 2268 | FGR | FGR proto-oncogene, Src fam... | NM_005248.3 | 100% | 100% | |
| 4 | human | 2268 | FGR | FGR proto-oncogene, Src fam... | XM_006710452.2 | 100% | 100% | |
| 5 | human | 2268 | FGR | FGR proto-oncogene, Src fam... | XM_011541010.1 | 100% | 100% | |
| 6 | human | 2268 | FGR | FGR proto-oncogene, Src fam... | XM_011541011.2 | 86.9% | 82.6% | 226_227ins103;325_326ins104 |
| 7 | human | 2268 | FGR | FGR proto-oncogene, Src fam... | XM_011541012.2 | 77.5% | 70.1% | 1093_1094ins154;1230_1231ins203 |
| 8 | human | 2268 | FGR | FGR proto-oncogene, Src fam... | XM_011541013.3 | 66.5% | 64.6% | 1017_1018insGGCA;1056_1057ins527 |
| 9 | human | 2268 | FGR | FGR proto-oncogene, Src fam... | XR_946583.3 | 65.6% | 1_196del;1213_1214insGGCA;1780_2407del | |
| 10 | human | 2268 | FGR | FGR proto-oncogene, Src fam... | XM_011541014.3 | 61.4% | 61.4% | 0_1ins612 |
| 11 | human | 2268 | FGR | FGR proto-oncogene, Src fam... | XM_017000673.1 | 61.4% | 61.4% | 0_1ins612 |
| 12 | human | 2268 | FGR | FGR proto-oncogene, Src fam... | XM_017000674.1 | 61.4% | 61.4% | 0_1ins612 |
| 13 | mouse | 14191 | Fgr | FGR proto-oncogene, Src fam... | NM_010208.4 | 82.8% | 84.1% | (many diffs) |
| 14 | mouse | 14191 | Fgr | FGR proto-oncogene, Src fam... | XM_006538544.3 | 82.8% | 84.1% | (many diffs) |
| 15 | mouse | 14191 | Fgr | FGR proto-oncogene, Src fam... | XM_006538545.3 | 82.8% | 84.1% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1653
- ORF length:
- 1587
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggg ctgtgtgttc tgcaagaaat tggagccggt ggccacggcc aaggaggatg 121 ctggcctgga aggggacttc agaagctacg gggcagcaga ccactatggg cctgacccca 181 ctaaggcccg gcctgcatcc tcatttgccc acatccccaa ctacagcaac ttctcctctc 241 aggccatcaa ccctggcttc cttgatagtg gcaccatcag gggtgtgtca gggattgggg 301 tgaccctgtt cattgccctg tatgactatg aggctcgaac tgaggatgac ctcaccttca 361 ccaagggcga gaagttccac atcctgaaca atactgaagg tgactggtgg gaggctcggt 421 ctctcagctc cggaaaaact ggctgcattc ccagcaacta cgtggcccct gttgactcaa 481 tccaagctga agagtggtac tttggaaaga ttgggagaaa ggatgcagag aggcagctgc 541 tttcaccagg caacccccag ggggcctttc tcattcggga aagcgagacc accaaaggtg 601 cctactccct gtccatccgg gactgggatc agaccagagg cgatcatgtg aagcattaca 661 agatccgcaa actggacatg ggcggctact acatcaccac acgggttcag ttcaactcgg 721 tgcaggagct ggtgcagcac tacatggagg tgaatgacgg gctgtgcaac ctgctcatcg 781 cgccctgcac catcatgaag ccgcagacgc tgggcctggc caaggacgcc tgggagatca 841 gccgcagctc catcacgctg gagcgccggc tgggcaccgg ctgcttcggg gatgtgtggc 901 tgggcacgtg gaacggcagc actaaggtgg cggtgaagac gctgaagccg ggcaccatgt 961 ccccgaaggc cttcctggag gaggcgcagg tcatgaagct gctgcggcac gacaagctgg 1021 tgcagctgta cgccgtggtg tcggaggagc ccatctacat cgtgaccgag ttcatgtgtc 1081 acggcagctt gctggatttt ctcaagaacc cagagggcca ggatttgagg ctgccccaat 1141 tggtggacat ggcagcccag gtagctgagg gcatggccta catggaacgc atgaactaca 1201 ttcaccgcga cctgagggca gccaacatcc tggttgggga gcggctggcg tgcaagatcg 1261 cagactttgg cttggcgcgt ctcatcaagg acgatgagta caacccctgc caaggttcCA 1321 AGTTCCCCAT CAAGTGGACA GCCCCAGAAG CTGCCCTCTT TGGCAGATTC ACCATCAAGT 1381 CAGACGTGTG GTCCTTTGGG ATCCTGCTCA CTGAGCTCAT CACCAAGGGC CGAATCCCCT 1441 ACCCAGGCAT GAATAAACGG GAAGTGTTGG AACAGGTGGA GCAGGGCTAC CACATGCCGT 1501 GCCCTCCAGG CTGCCCAGCA TCCCTGTACG AGGCCATGGA ACAGACCTGG CGTCTGGACC 1561 CGGAGGAGAG GCCTACCTTC GAGTACCTGC AGTCCTTCCT GGAGGACTAC TTCACCTCCG 1621 CTGAACCACA GTACCAGCCC GGGGATCAGA CATACCCAAC TTTCTTGTAC AAAGTGGTTG 1681 ATATCGGTAA GCCTATCCCT AACCCTCTCC TCGGTCTCGA TTCTACGTAG TAATGAACTA 1741 GTCCGTAACT TGAAAGTATT TCGATTTCTT GGCTTTATAT ATCTTGTGGA AAGGACGACG 1801 GACTTCGCGT GCGTAGGTCT TCACGCGTTA AGTCgacaat caacctctgg attacaaaat 1861 ttgtgaaaga tt