Transcript: Human NM_001370549.1

Homo sapiens solute carrier family 16 member 11 (SLC16A11), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-02
Taxon:
Homo sapiens (human)
Gene:
SLC16A11 (162515)
Length:
1726
CDS:
325..1668

Additional Resources:

NCBI RefSeq record:
NM_001370549.1
NBCI Gene record:
SLC16A11 (162515)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001370549.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000038594 GCAGCTTCTTCTCGATACTTT pLKO.1 804 CDS 100% 5.625 7.875 N SLC16A11 n/a
2 TRCN0000038596 CGCGATAAACGGGCTGTCCTA pLKO.1 390 CDS 100% 0.880 1.232 N SLC16A11 n/a
3 TRCN0000038595 CCTCCTGTCTGGTTCTTTGAT pLKO.1 1479 CDS 100% 5.625 3.938 N SLC16A11 n/a
4 TRCN0000444714 AGGGCTGGTGATGATGCTGAT pLKO_005 1383 CDS 100% 4.050 2.835 N SLC16A11 n/a
5 TRCN0000038598 GCCTTCTCAATCTTTGCTCTA pLKO.1 979 CDS 100% 4.050 2.835 N SLC16A11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001370549.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09742 pDONR223 100% 94.8% 94.9% None 0_1ins72;207C>T n/a
2 ccsbBroad304_09742 pLX_304 0% 94.8% 94.9% V5 0_1ins72;207C>T n/a
3 TRCN0000478116 TATCCCGGCGCAAAGTCCCTTGCA pLX_317 12% 94.8% 94.9% V5 0_1ins72;207C>T n/a
Download CSV