Construct: ORF TRCN0000478257
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF010577.1_s317c1
- Derived from:
- ccsbBroadEn_13869
- DNA Barcode:
- GCGAGGCAGAGTCGTTTTGCCCGA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- HLA-A (3105)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000478257
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 3105 | HLA-A | major histocompatibility co... | NM_001242758.1 | 99.5% | 98.6% | (many diffs) |
2 | human | 3105 | HLA-A | major histocompatibility co... | NM_002116.8 | 97.8% | 94.7% | (many diffs) |
3 | human | 3106 | HLA-B | major histocompatibility co... | NM_005514.8 | 89.2% | 82.7% | (many diffs) |
4 | human | 3107 | HLA-C | major histocompatibility co... | NM_001243042.1 | 88.2% | 80% | (many diffs) |
5 | human | 3107 | HLA-C | major histocompatibility co... | NM_002117.6 | 88.1% | 79.5% | (many diffs) |
6 | human | 3133 | HLA-E | major histocompatibility co... | NM_005516.6 | 84.7% | 74.3% | (many diffs) |
7 | human | 3133 | HLA-E | major histocompatibility co... | XM_017010809.2 | 83.3% | 70.4% | (many diffs) |
8 | human | 3135 | HLA-G | major histocompatibility co... | NM_002127.5 | 82.7% | 74.7% | (many diffs) |
9 | human | 3135 | HLA-G | major histocompatibility co... | XM_024446420.1 | 82.7% | 74.7% | (many diffs) |
10 | human | 3135 | HLA-G | major histocompatibility co... | NM_001363567.1 | 81.6% | 73.7% | (many diffs) |
11 | human | 3134 | HLA-F | major histocompatibility co... | NM_018950.2 | 80.9% | 74.2% | (many diffs) |
12 | human | 3134 | HLA-F | major histocompatibility co... | XM_011514564.1 | 80.1% | 72.3% | (many diffs) |
13 | human | 3134 | HLA-F | major histocompatibility co... | XM_017010813.1 | 78.8% | 70.3% | (many diffs) |
14 | human | 3133 | HLA-E | major histocompatibility co... | XM_017010807.1 | 75.4% | 61.9% | (many diffs) |
15 | human | 3133 | HLA-E | major histocompatibility co... | XM_017010808.1 | 75.4% | 61.9% | (many diffs) |
16 | human | 3134 | HLA-F | major histocompatibility co... | XM_017010812.1 | 73% | 65% | (many diffs) |
17 | human | 3134 | HLA-F | major histocompatibility co... | XM_017010811.1 | 70.7% | 59.6% | (many diffs) |
18 | human | 3134 | HLA-F | major histocompatibility co... | XM_017010810.1 | 70.6% | 62.7% | (many diffs) |
19 | human | 3134 | HLA-F | major histocompatibility co... | NM_001098479.2 | 69.5% | 61.7% | (many diffs) |
20 | human | 3135 | HLA-G | major histocompatibility co... | XM_017010817.1 | 61.4% | 55.6% | (many diffs) |
21 | human | 3135 | HLA-G | major histocompatibility co... | XM_017010818.1 | 61.4% | 55.6% | (many diffs) |
22 | human | 3136 | HLA-H | major histocompatibility co... | NR_001434.4 | 59.3% | (many diffs) | |
23 | human | 3134 | HLA-F | major histocompatibility co... | NM_001098478.2 | 58.1% | 50.9% | (many diffs) |
24 | human | 3134 | HLA-F | major histocompatibility co... | XM_017010815.1 | 54.7% | 51.7% | (many diffs) |
25 | human | 3134 | HLA-F | major histocompatibility co... | XM_017010814.1 | 47.9% | 43.3% | (many diffs) |
26 | human | 3134 | HLA-F | major histocompatibility co... | XR_001743373.1 | 29.1% | (many diffs) | |
27 | human | 3134 | HLA-F | major histocompatibility co... | XR_001743374.1 | 28% | (many diffs) | |
28 | human | 3134 | HLA-F | major histocompatibility co... | XR_001743376.1 | 27.4% | (many diffs) | |
29 | human | 3139 | HLA-L | major histocompatibility co... | NR_027822.1 | 16.1% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1161
- ORF length:
- 1095
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc cgtcatggcg ccccgaaccc tcntcctgct actctcgggg gcnctggccc 121 tgacccagac ctgggcgggc tcncactcca tgaggtattt cttcacatcc gtgtcccggc 181 ccggccgcgg ggagccccgc ttcatcgcng tgggctacgt ggacgacacg cagttcgtgc 241 ggttcgacag cgacgccgcg agccaganga tggagccgcg ggcgccgtgg atagagcagg 301 aggggccgga gtattgggac caggagacac ggaatatgaa ggcccactca cagactgacc 361 gagcgaacct ggggaccctg cgcggctact acaaccagag cgaggacggt tctcacacca 421 tccagataat gtatggctgc gacgtggggc cggacgggcg cttcctccgc gggtaccggc 481 aggacgccta cgacggcaag gattacatcg ccctgaacga ggacctgcgc tcttggaccg 541 cggcggacat ggcagctcag atcaccaagc gcaagtggga ggcggtccat gcggcggagc 601 agcggagagt ctacctggag ggccggtgcg tggacgggct ccgcagatac ctggagaacg 661 ggaaggagac gctgcagcgc acggaccccc ccaagacaca tatgacccac caccccatct 721 ctgaccatga ggccaccctg aggtgctggg ccctgggctt ctaccctgcg gagatcacac 781 tgacctggca gcgggatggg gaggaccaga cccaggacac ggagctcgtg gagaccaggc 841 ctgcagggga tggaaccttc cagaagtggg cggctgtggt ggtgccTTCT GGAGAGGAGC 901 AGAGATACAC CTGCCATGTG CAGCATGAGG GTCTGCCCAA GCCCCTCACC CTGAGATGGG 961 AGCTGTCTTC CCAGCCCACC ATCCCCATCG TGGGCATCAT TGCTGGCCTG GTTCTCCTTG 1021 GAGCTGTGAT CACTGGAGCT GTGGTCGCTG CCGTGATGTG GAGGAGGAAG AGCTCAGATA 1081 GAAAAGGAGG GAGTTACACT CAGGCTGCAA GCAGTGACAG TGCCCAGGGC TCTGATGTGT 1141 CTCTCACAGC TTGTAAAGTG TGCCCAACTT TCTTGTACAA AGTGGTTGAT ATCGGTAAGC 1201 CTATCCCTAA CCCTCTCCTC GGTCTCGATT CTACGTAGTA ATGAACTAGT CCGTAACTTG 1261 AAAGTATTTC GATTTCTTGG CTTTATATAT CTTGTGGAAA GGACGAGCGA GGCAGAGTCG 1321 TTTTGCCCGA ACGCGTTAAG TCgacaatca acctctggat tacaaaattt gtgaaagatt