Construct: ORF TRCN0000478331
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF016559.1_s317c1
- Derived from:
- ccsbBroadEn_02266
- DNA Barcode:
- AAACGAAGCCGAGAGTTAGCACTT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- RHOBTB1 (9886)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000478331
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 9886 | RHOBTB1 | Rho related BTB domain cont... | NM_001242359.2 | 100% | 100% | |
| 2 | human | 9886 | RHOBTB1 | Rho related BTB domain cont... | NM_001350902.2 | 100% | 100% | |
| 3 | human | 9886 | RHOBTB1 | Rho related BTB domain cont... | NM_001350903.2 | 100% | 100% | |
| 4 | human | 9886 | RHOBTB1 | Rho related BTB domain cont... | NM_001350904.2 | 100% | 100% | |
| 5 | human | 9886 | RHOBTB1 | Rho related BTB domain cont... | NM_001350905.2 | 100% | 100% | |
| 6 | human | 9886 | RHOBTB1 | Rho related BTB domain cont... | NM_014836.5 | 100% | 100% | |
| 7 | human | 9886 | RHOBTB1 | Rho related BTB domain cont... | XM_006718085.1 | 100% | 100% | |
| 8 | human | 9886 | RHOBTB1 | Rho related BTB domain cont... | XM_011540424.1 | 100% | 100% | |
| 9 | human | 9886 | RHOBTB1 | Rho related BTB domain cont... | XM_017017000.2 | 100% | 100% | |
| 10 | human | 9886 | RHOBTB1 | Rho related BTB domain cont... | XM_024448270.1 | 100% | 100% | |
| 11 | human | 9886 | RHOBTB1 | Rho related BTB domain cont... | XM_024448271.1 | 100% | 100% | |
| 12 | human | 9886 | RHOBTB1 | Rho related BTB domain cont... | XM_024448272.1 | 100% | 100% | |
| 13 | human | 9886 | RHOBTB1 | Rho related BTB domain cont... | XM_024448273.1 | 100% | 100% | |
| 14 | human | 9886 | RHOBTB1 | Rho related BTB domain cont... | XM_011540425.1 | 89.2% | 87% | 1812_1813ins106;1863_1864ins119 |
| 15 | human | 9886 | RHOBTB1 | Rho related BTB domain cont... | XM_017017002.2 | 89.2% | 87% | 1812_1813ins106;1863_1864ins119 |
| 16 | human | 9886 | RHOBTB1 | Rho related BTB domain cont... | XM_011540426.1 | 84.9% | 82.6% | (many diffs) |
| 17 | human | 9886 | RHOBTB1 | Rho related BTB domain cont... | NM_001350906.2 | 82.7% | 82.7% | 0_1ins360 |
| 18 | human | 9886 | RHOBTB1 | Rho related BTB domain cont... | NM_001350907.2 | 82.7% | 82.7% | 0_1ins360 |
| 19 | human | 9886 | RHOBTB1 | Rho related BTB domain cont... | NM_001350908.2 | 82.7% | 82.7% | 0_1ins360 |
| 20 | human | 9886 | RHOBTB1 | Rho related BTB domain cont... | NM_001350909.2 | 82.7% | 82.7% | 0_1ins360 |
| 21 | human | 9886 | RHOBTB1 | Rho related BTB domain cont... | NM_001350910.2 | 82.7% | 82.7% | 0_1ins360 |
| 22 | human | 9886 | RHOBTB1 | Rho related BTB domain cont... | NM_001350911.2 | 82.7% | 82.7% | 0_1ins360 |
| 23 | human | 9886 | RHOBTB1 | Rho related BTB domain cont... | XM_011540428.1 | 75.8% | 75.5% | (many diffs) |
| 24 | human | 9886 | RHOBTB1 | Rho related BTB domain cont... | XR_945895.1 | 46.6% | 1_232del;2044_2045ins106;2215_4143del | |
| 25 | human | 9886 | RHOBTB1 | Rho related BTB domain cont... | XR_945894.2 | 46.3% | 1_232del;2154_2295del;2463_4509del | |
| 26 | human | 9886 | RHOBTB1 | Rho related BTB domain cont... | XR_001747268.1 | 30.6% | (many diffs) | |
| 27 | mouse | 69288 | Rhobtb1 | Rho-related BTB domain cont... | NM_001081347.1 | 83.1% | 88.7% | (many diffs) |
| 28 | mouse | 69288 | Rhobtb1 | Rho-related BTB domain cont... | NM_001252636.1 | 83.1% | 88.7% | (many diffs) |
| 29 | mouse | 69288 | Rhobtb1 | Rho-related BTB domain cont... | NM_001252637.1 | 83.1% | 88.7% | (many diffs) |
| 30 | mouse | 69288 | Rhobtb1 | Rho-related BTB domain cont... | XM_006514048.3 | 83.1% | 88.7% | (many diffs) |
| 31 | mouse | 69288 | Rhobtb1 | Rho-related BTB domain cont... | XM_006514049.3 | 83.1% | 88.7% | (many diffs) |
| 32 | mouse | 69288 | Rhobtb1 | Rho-related BTB domain cont... | XM_006514051.3 | 83.1% | 88.7% | (many diffs) |
| 33 | mouse | 69288 | Rhobtb1 | Rho-related BTB domain cont... | XM_011243553.2 | 83.1% | 88.7% | (many diffs) |
| 34 | mouse | 69288 | Rhobtb1 | Rho-related BTB domain cont... | NM_001252638.1 | 68.4% | 71.9% | (many diffs) |
| 35 | mouse | 69288 | Rhobtb1 | Rho-related BTB domain cont... | XM_006514052.3 | 68.4% | 71.9% | (many diffs) |
| 36 | mouse | 69288 | Rhobtb1 | Rho-related BTB domain cont... | XM_006514053.3 | 68.4% | 71.9% | (many diffs) |
| 37 | mouse | 69288 | Rhobtb1 | Rho-related BTB domain cont... | XM_006514054.1 | 68.4% | 71.9% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 2154
- ORF length:
- 2088
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgga cgctgacatg gactacgaaa gacccaacgt tgaaactatc aaatgtgtgg 121 tcgtgggtga caatgccgtg gggaagacgc gcttgatctg tgccagggcg tgcaacacca 181 cactcacgca gtatcagctg ctggccaccc acgtgccaac agtgtgggcg attgaccagt 241 accgcgtgtg ccaggaggtc ttggagcgtt ctcgggatgt tgttgatgaa gtgagtgttt 301 ctctcaggct ttgggatact tttggtgatc atcacaaaga cagacgcttt gcatatggca 361 ggtctgatgt tgtggtcctc tgtttttcga ttgctaatcc caattcccta aatcatgtga 421 aaagcatgtg gtatccagaa atcaagcact tttgccctcg aacacccgtt atccttgttg 481 ggtgccagct tgatctccgc tatgccgacc tggaagctgt taatcgagcc aggcgcccgt 541 tagcaaggcc cataaagaga ggggatattt tgcccccaga aaaaggccga gaggtagcaa 601 aggaacttgg cttaccatac tatgaaacaa gcgtgtttga ccagtttggt atcaaggatg 661 tgtttgacaa tgcaatccga gcagcgctga tttcccgcag gcacctgcaa ttctggaaat 721 cccacctaaa gaaagtccag aaacctttac ttcaggcacc cttcctacct ccaaaagccc 781 ctccaccggt catcaaaatt ccagagtgtc cttccatggg gacaaatgaa gctgcctgtt 841 tactggacaa tcctctatgt gccgatgttc tgttcatcct tcaggaccag gaacacatct 901 ttgcacatcg aatttacctc gctacctctt cttccaaatt ttatgatctg tttttaatgg 961 aatgtgaaga atccccaaat gggagtgaag gagcctgtga gaaagagaag cagagcagag 1021 atttccaggg gcggatattg agtgtcgacc cagaggaaga aagggaggag ggcccgccta 1081 ggattcctca ggccgaccag tggaagtctt caaacaagag cctggtggag gctctggggc 1141 tggaagccga gggtgcagtt cctgagacac agactttgac cggatggagt aaggggttca 1201 ttggcatgca cagggaaatg caagtcaacc ccatttcaaa gcggatgggg cccatgactg 1261 tggtcaggat ggacgcttca gtccagccag gcccttttcg gaccctgctc cagtttcttt 1321 atacgggaca actggatgaa aaggaaaagg atttggtggg cctggctcag atcgcagagg 1381 tcctcgagat gttcgatttg aggatgatgg tggaaaacat catgaacaag gaagccttca 1441 tgaaccagga gattacgaaa gcctttcacg taaggaaagc caatcggata aaagagtgtc 1501 tcagcaaggg aacgttctcg gacgtgacat ttaaattgga cgatggagcc atcagtgccc 1561 acaagccgct gctgatctgt agctgtgagt ggatggcagc catgttcggg gggtcatttg 1621 tggaaagtgc caacagtgag gtgtatctcc cgaacataaa caagatatca atgcaagcag 1681 tattggatta tctctatacc aagcagttgt ctcctaactt ggatctggac ccgctggaat 1741 taattgcctt ggcaaacaga ttttgcctgc cacacttggt tgcacttgca gaacagcatg 1801 ccgttcagga gttgaccaaa gccgccacga gtggcgtggg cattgacgga gaagtgctct 1861 cttacttgga attggcTCAG TTTCACAATG CCCACCAGTT GGCCGCCTGG TGTTTGCACC 1921 ACATCTGCAC CAACTACAAC AGTGTATGCT CCAAGTTCCG TAAGGAAATC AAATCAAAAT 1981 CTGCAGACAA CCAGGAATAC TTCGAGCGGC ACCGCTGGCC CCCTGTGTGG TACCTGAAGG 2041 AAGAAGATCA CTACCAGCGT GTGAAAAGGG AACGAGAGAA GGAAGATATT GCACTAAATA 2101 AGCATCGCTC AAGACGAAAG TGGTGCTTCT GGAATTCATC TCCAGCAGTG GCCTGCCCAA 2161 CTTTCTTGTA CAAAGTGGTT GATATCGGTA AGCCTATCCC TAACCCTCTC CTCGGTCTCG 2221 ATTCTACGTA GTAATGAACT AGTCCGTAAC TTGAAAGTAT TTCGATTTCT TGGCTTTATA 2281 TATCTTGTGG AAAGGACGAA AACGAAGCCG AGAGTTAGCA CTTACGCGTT AAGTCgacaa 2341 tcaacctctg gattacaaaa tttgtgaaag att