Transcript: Human XM_024448270.1

PREDICTED: Homo sapiens Rho related BTB domain containing 1 (RHOBTB1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RHOBTB1 (9886)
Length:
4457
CDS:
323..2413

Additional Resources:

NCBI RefSeq record:
XM_024448270.1
NBCI Gene record:
RHOBTB1 (9886)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024448270.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000423102 ACGTTCTCGGACGTGACATTT pLKO_005 1769 CDS 100% 13.200 18.480 N RHOBTB1 n/a
2 TRCN0000415850 CATCTTTGCACATCGAATTTA pLKO_005 1153 CDS 100% 15.000 10.500 N RHOBTB1 n/a
3 TRCN0000252967 CGCTACCTCTTCTTCCAAATT pLKO_005 1177 CDS 100% 13.200 9.240 N Rhobtb1 n/a
4 TRCN0000047756 GCTAATCCCAATTCCCTAAAT pLKO.1 650 CDS 100% 13.200 9.240 N RHOBTB1 n/a
5 TRCN0000047757 GCTTACCATACTATGAAACAA pLKO.1 867 CDS 100% 5.625 3.938 N RHOBTB1 n/a
6 TRCN0000047754 GCAGTATTGGATTATCTCTAT pLKO.1 1934 CDS 100% 4.950 3.465 N RHOBTB1 n/a
7 TRCN0000047755 GCTCCAAGTTCCGTAAGGAAA pLKO.1 2205 CDS 100% 4.950 3.465 N RHOBTB1 n/a
8 TRCN0000047753 GCCGATGTTCTGTTCATCCTT pLKO.1 1118 CDS 100% 3.000 2.100 N RHOBTB1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024448270.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02266 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02266 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000478331 AAACGAAGCCGAGAGTTAGCACTT pLX_317 13.6% 100% 100% V5 n/a
4 ccsbBroadEn_07503 pDONR223 100% 99.9% 100% None 915T>C n/a
5 ccsbBroad304_07503 pLX_304 0% 99.9% 100% V5 915T>C n/a
6 TRCN0000474909 TGTCAGGATGCTTAGACGGTTTGA pLX_317 14% 99.9% 100% V5 915T>C n/a
Download CSV