Transcript: Mouse XM_006514049.3

PREDICTED: Mus musculus Rho-related BTB domain containing 1 (Rhobtb1), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Rhobtb1 (69288)
Length:
4543
CDS:
354..2441

Additional Resources:

NCBI RefSeq record:
XM_006514049.3
NBCI Gene record:
Rhobtb1 (69288)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006514049.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000226343 ATCTTTGCGCACCGCATTTAC pLKO_005 1185 CDS 100% 13.200 18.480 N Rhobtb1 n/a
2 TRCN0000226341 CCCTTAGCAAGGCCCATAAAG pLKO_005 825 CDS 100% 13.200 18.480 N Rhobtb1 n/a
3 TRCN0000252966 GGAAAGCCAATCGGATCAAAG pLKO_005 1759 CDS 100% 10.800 15.120 N Rhobtb1 n/a
4 TRCN0000226344 TGTTGACAGCTCTACTATAAA pLKO_005 2484 3UTR 100% 15.000 12.000 N Rhobtb1 n/a
5 TRCN0000252969 GATGAGCCACGTTGGTATAAT pLKO_005 3015 3UTR 100% 15.000 10.500 N Rhobtb1 n/a
6 TRCN0000252965 TGAGGTTCACCTCCCAAATAT pLKO_005 1922 CDS 100% 15.000 10.500 N Rhobtb1 n/a
7 TRCN0000252968 ACCTTCTCAGACGTGACATTT pLKO_005 1797 CDS 100% 13.200 9.240 N Rhobtb1 n/a
8 TRCN0000252967 CGCTACCTCTTCTTCCAAATT pLKO_005 1208 CDS 100% 13.200 9.240 N Rhobtb1 n/a
9 TRCN0000218075 TGAGGATGATGGTAGAGAATA pLKO_005 1684 CDS 100% 13.200 9.240 N Rhobtb1 n/a
10 TRCN0000226342 ACTACGAGACCAGCGTGTTTG pLKO_005 907 CDS 100% 10.800 7.560 N Rhobtb1 n/a
11 TRCN0000166364 CACACACACACACACACACAA pLKO.1 3795 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006514049.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02266 pDONR223 100% 83.1% 88.7% None (many diffs) n/a
2 ccsbBroad304_02266 pLX_304 0% 83.1% 88.7% V5 (many diffs) n/a
3 TRCN0000478331 AAACGAAGCCGAGAGTTAGCACTT pLX_317 13.6% 83.1% 88.7% V5 (many diffs) n/a
4 ccsbBroadEn_07503 pDONR223 100% 83.1% 88.7% None (many diffs) n/a
5 ccsbBroad304_07503 pLX_304 0% 83.1% 88.7% V5 (many diffs) n/a
6 TRCN0000474909 TGTCAGGATGCTTAGACGGTTTGA pLX_317 14% 83.1% 88.7% V5 (many diffs) n/a
Download CSV