Transcript: Human XM_017017002.2

PREDICTED: Homo sapiens Rho related BTB domain containing 1 (RHOBTB1), transcript variant X11, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RHOBTB1 (9886)
Length:
4168
CDS:
140..2005

Additional Resources:

NCBI RefSeq record:
XM_017017002.2
NBCI Gene record:
RHOBTB1 (9886)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017017002.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000423102 ACGTTCTCGGACGTGACATTT pLKO_005 1586 CDS 100% 13.200 18.480 N RHOBTB1 n/a
2 TRCN0000415850 CATCTTTGCACATCGAATTTA pLKO_005 970 CDS 100% 15.000 10.500 N RHOBTB1 n/a
3 TRCN0000252967 CGCTACCTCTTCTTCCAAATT pLKO_005 994 CDS 100% 13.200 9.240 N Rhobtb1 n/a
4 TRCN0000047756 GCTAATCCCAATTCCCTAAAT pLKO.1 467 CDS 100% 13.200 9.240 N RHOBTB1 n/a
5 TRCN0000047757 GCTTACCATACTATGAAACAA pLKO.1 684 CDS 100% 5.625 3.938 N RHOBTB1 n/a
6 TRCN0000047754 GCAGTATTGGATTATCTCTAT pLKO.1 1751 CDS 100% 4.950 3.465 N RHOBTB1 n/a
7 TRCN0000047753 GCCGATGTTCTGTTCATCCTT pLKO.1 935 CDS 100% 3.000 2.100 N RHOBTB1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017017002.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02266 pDONR223 100% 89.2% 87% None 1812_1813ins106;1863_1864ins119 n/a
2 ccsbBroad304_02266 pLX_304 0% 89.2% 87% V5 1812_1813ins106;1863_1864ins119 n/a
3 TRCN0000478331 AAACGAAGCCGAGAGTTAGCACTT pLX_317 13.6% 89.2% 87% V5 1812_1813ins106;1863_1864ins119 n/a
4 ccsbBroadEn_07503 pDONR223 100% 89.1% 87% None 915T>C;1812_1813ins106;1863_1864ins119 n/a
5 ccsbBroad304_07503 pLX_304 0% 89.1% 87% V5 915T>C;1812_1813ins106;1863_1864ins119 n/a
6 TRCN0000474909 TGTCAGGATGCTTAGACGGTTTGA pLX_317 14% 89.1% 87% V5 915T>C;1812_1813ins106;1863_1864ins119 n/a
Download CSV