Construct: ORF TRCN0000478477
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF005920.1_s317c1
- Derived from:
- ccsbBroadEn_12416
- DNA Barcode:
- TTATCTGGAGTACACCTTAATACC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- ARHGAP22 (58504)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000478477
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 58504 | ARHGAP22 | Rho GTPase activating prote... | NM_001256024.2 | 99.9% | 100% | 330C>T;639A>G |
| 2 | human | 58504 | ARHGAP22 | Rho GTPase activating prote... | XM_011540002.2 | 98.5% | 97.7% | (many diffs) |
| 3 | human | 58504 | ARHGAP22 | Rho GTPase activating prote... | XM_011540003.1 | 98.5% | 97.7% | (many diffs) |
| 4 | human | 58504 | ARHGAP22 | Rho GTPase activating prote... | XM_024448099.1 | 98.5% | 97.7% | (many diffs) |
| 5 | human | 58504 | ARHGAP22 | Rho GTPase activating prote... | NM_021226.4 | 97.6% | 97.7% | 330C>T;449_450ins48;591A>G |
| 6 | human | 58504 | ARHGAP22 | Rho GTPase activating prote... | NM_001256025.3 | 96.3% | 95.5% | (many diffs) |
| 7 | human | 58504 | ARHGAP22 | Rho GTPase activating prote... | NM_001347738.2 | 96.3% | 95.5% | (many diffs) |
| 8 | human | 58504 | ARHGAP22 | Rho GTPase activating prote... | NM_001347735.2 | 91.6% | 91.7% | 318_319ins177;462A>G |
| 9 | human | 58504 | ARHGAP22 | Rho GTPase activating prote... | XM_011540006.2 | 90.3% | 89.5% | (many diffs) |
| 10 | human | 58504 | ARHGAP22 | Rho GTPase activating prote... | XM_005270014.3 | 86.8% | 85.2% | (many diffs) |
| 11 | human | 58504 | ARHGAP22 | Rho GTPase activating prote... | XM_011540005.1 | 86.7% | 85.4% | (many diffs) |
| 12 | human | 58504 | ARHGAP22 | Rho GTPase activating prote... | NM_001256026.2 | 84.4% | 83.1% | (many diffs) |
| 13 | human | 58504 | ARHGAP22 | Rho GTPase activating prote... | XM_011540011.2 | 78% | 77% | (many diffs) |
| 14 | human | 58504 | ARHGAP22 | Rho GTPase activating prote... | XM_011540012.3 | 77.1% | 77% | (many diffs) |
| 15 | human | 58504 | ARHGAP22 | Rho GTPase activating prote... | XM_017016471.2 | 77.1% | 77% | (many diffs) |
| 16 | human | 58504 | ARHGAP22 | Rho GTPase activating prote... | NR_144645.2 | 73.4% | (many diffs) | |
| 17 | human | 58504 | ARHGAP22 | Rho GTPase activating prote... | XR_002956998.1 | 69.2% | (many diffs) | |
| 18 | human | 58504 | ARHGAP22 | Rho GTPase activating prote... | NR_144646.2 | 67.8% | (many diffs) | |
| 19 | human | 58504 | ARHGAP22 | Rho GTPase activating prote... | XR_001747166.2 | 66.8% | (many diffs) | |
| 20 | human | 58504 | ARHGAP22 | Rho GTPase activating prote... | NR_144643.2 | 64.4% | (many diffs) | |
| 21 | human | 58504 | ARHGAP22 | Rho GTPase activating prote... | XR_002957004.1 | 64.2% | (many diffs) | |
| 22 | human | 58504 | ARHGAP22 | Rho GTPase activating prote... | NR_144642.2 | 62.8% | (many diffs) | |
| 23 | human | 58504 | ARHGAP22 | Rho GTPase activating prote... | XR_002956999.1 | 61.4% | (many diffs) | |
| 24 | human | 58504 | ARHGAP22 | Rho GTPase activating prote... | NR_144644.2 | 60.5% | (many diffs) | |
| 25 | human | 58504 | ARHGAP22 | Rho GTPase activating prote... | NR_045675.2 | 59.9% | (many diffs) | |
| 26 | human | 58504 | ARHGAP22 | Rho GTPase activating prote... | XR_002957001.1 | 56.3% | (many diffs) | |
| 27 | human | 58504 | ARHGAP22 | Rho GTPase activating prote... | XM_024448101.1 | 55.4% | 55.4% | 0_1ins954 |
| 28 | human | 58504 | ARHGAP22 | Rho GTPase activating prote... | XM_011540013.3 | 54.8% | 45.6% | (many diffs) |
| 29 | human | 58504 | ARHGAP22 | Rho GTPase activating prote... | XM_017016476.1 | 53.5% | 45.1% | (many diffs) |
| 30 | human | 58504 | ARHGAP22 | Rho GTPase activating prote... | XM_024448100.1 | 52.6% | 43.5% | (many diffs) |
| 31 | human | 58504 | ARHGAP22 | Rho GTPase activating prote... | XM_011540015.3 | 47.9% | 46.7% | (many diffs) |
| 32 | human | 58504 | ARHGAP22 | Rho GTPase activating prote... | XR_002957000.1 | 44.1% | (many diffs) | |
| 33 | human | 58504 | ARHGAP22 | Rho GTPase activating prote... | XR_002957003.1 | 40.8% | (many diffs) | |
| 34 | human | 58504 | ARHGAP22 | Rho GTPase activating prote... | XR_002957002.1 | 40.5% | (many diffs) | |
| 35 | human | 58504 | ARHGAP22 | Rho GTPase activating prote... | XM_024448102.1 | 16.4% | 14.1% | (many diffs) |
| 36 | human | 58504 | ARHGAP22 | Rho GTPase activating prote... | XM_024448103.1 | 15.6% | 13.7% | (many diffs) |
| 37 | human | 58504 | ARHGAP22 | Rho GTPase activating prote... | XM_024448104.1 | 15.5% | 13.9% | (many diffs) |
| 38 | human | 58504 | ARHGAP22 | Rho GTPase activating prote... | XM_024448105.1 | 15% | 13.7% | (many diffs) |
| 39 | human | 58504 | ARHGAP22 | Rho GTPase activating prote... | NM_001347737.1 | 11.2% | 10.9% | (many diffs) |
| 40 | human | 58504 | ARHGAP22 | Rho GTPase activating prote... | NM_001347736.1 | 10.7% | 9.5% | (many diffs) |
| 41 | human | 58504 | ARHGAP22 | Rho GTPase activating prote... | XM_024448106.1 | 10.7% | 9.5% | (many diffs) |
| 42 | mouse | 239027 | Arhgap22 | Rho GTPase activating prote... | XM_017316007.1 | 42.2% | 41.4% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 2211
- ORF length:
- 2142
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gctgagccca aagatcaggc aggccaggag ggcccgctcc aaaagcctag 121 tgatggggga gcagagccgg agccctgggc ggatgccgtg ccctcacagg ctgggccccg 181 tgctgaaggc gggctggctg aagaagcaga ggagcatcat gaagaactgg cagcagcgct 241 ggtttgtgct gcgtggggat cagcttttct actacaagga caaagatgag atcaagcccc 301 agggatttat ttctctacaa gggacacagg tgactgaact tcctcctggc cccgaggacc 361 cagggaagca cctctttgag atcagcccag gtggtgctgg ggagcgggag aaggtgccgg 421 ccaaccccga ggcgctcctg ctcatggcca gctcccagcg tgacatggag gactgggtgc 481 aggccatccg ccgagtcatc tgggccccgc tgggcggagg tactgcccgt agatcgcatg 541 cccaccctct agaacccttg cctccaggga tctttgggca gcgcctagag gaaacagtcc 601 accacgagcg gaagtatggc ccccgcctgg cgcccctgct ggtggagcag tgtgtggact 661 tcatccggga gcgcgggctc actgaggagg ggctgttccg catgccgggc caggccaacc 721 tggtgaggga cctgcaggat tccttcgact gtggggagaa gccactgttt gacagcacaa 781 cagacgtgca cacggtggcc tccctgctga agctgtacct gcgggagctc cccgagcccg 841 tggtcccctt cgccaggtac gaggacttcc tcagctgcgc ccagctgctc accaaggacg 901 agggggaggg cactctggag ttggctaaac aagtgagcaa ccttcctcag gcaaattaca 961 acctgctcag atacatctgc aagtttctgg atgaagttca ggcatactca aatgtcaaca 1021 agatgagtgt ccagaatctg gcaaccgttt ttggacctaa cattctgcgg ccacaggtag 1081 aggacccagt aaccatcatg gaaggcactt ccctcgtcca gcacctgatg accgtcctca 1141 tccgcaaaca cagccagctc ttcacggcac cggtcccgga agggcccacc tccccgcgcg 1201 ggggcctgca atgcgcagtg gggtggggct ccgaggaggt caccagggac agccaaggag 1261 agcccggcgg ccccggcctg cccgcgcaca ggacctcttc cctggacggg gcggccgtgg 1321 cggtgctctc cagaacagcc cccacggggc cggggagccg gtgcagccct gggaagaagg 1381 tgcagaccct gcccagttgg aagtcctcct tccggcagcc gaggtcccta tcgggaagcc 1441 cgaagggggg cggctcatcc ctggaggtgc ccatcatctc ctccggcggg aactggctta 1501 tgaacgggct gtcctccctg cgcggacacc gccgggcctc gtcgggagac cggctcaagg 1561 actcgggctc cgtgcagaga ctctccacct acgacaatgt gcccgcgccg ggcctggtcc 1621 ccggcatacc cagcgtggcc agtatggcgt ggtccggggc ctcgtccagc gagtcgtcgg 1681 tggggggctc actcagcagc tgcacggcct gccgcgccag cgactcgtct gcccgcagtt 1741 ccctgcacac cgactgggcc ctggagccct ccccgctccc cagcagcagc gaggacccca 1801 agtccctgga cctggaccac agcatggacg aggcgggcgc gggtgccagc aacagcgagc 1861 ccagcgagcc GGACAGCCCC ACCCGGGAAC ACGCGCGCCG CTCCGAGGCC TTACAGGGGC 1921 TGGTCACTGA GCTCAGGGCC GAGCTGTGCC GCCAGCGGAC TGAGTACGAG AGGAGTGTGA 1981 AAAGAATCGA AGAAGGGAGT GCTGACCTGA GAAAACGAAT GTCCCGGTTA GAAGAAGAAC 2041 TGGACCAGGA AAAGAAAAAA TACATCATGC TGGAAATAAA GCTGCGGAAC TCTGAACGGG 2101 CGCGGGAGGA TGCGGAGAGG AGGAACCAGC TGTTGCAGAG GGAAATGGAG GAGTTTTTTT 2161 CGACCCTAGG AAGCTTGACT GTTGGGGCAA AAGGTGCCAG GGCCCCAAAG TTGCCAACTT 2221 TCTTGTACAA AGTGGTTGAT ATCGGTAAGC CTATCCCTAA CCCTCTCCTC GGTCTCGATT 2281 CTACGTAGTA ATGAACTAGT CCGTAACTTG AAAGTATTTC GATTTCTTGG CTTTATATAT 2341 CTTGTGGAAA GGACGATTAT CTGGAGTACA CCTTAATACC ACGCGTTAAG TCgacaatca 2401 acctctggat tacaaaattt gtgaaagatt