Transcript: Human NM_001347737.1

Homo sapiens Rho GTPase activating protein 22 (ARHGAP22), transcript variant 9, mRNA.

Source:
NCBI, updated 2018-07-01
Taxon:
Homo sapiens (human)
Gene:
ARHGAP22 (58504)
Length:
1955
CDS:
336..581

Additional Resources:

NCBI RefSeq record:
NM_001347737.1
NBCI Gene record:
ARHGAP22 (58504)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001347737.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

No results found.

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001347737.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08780 pDONR223 100% 11.5% 28.7% None (many diffs) n/a
2 ccsbBroad304_08780 pLX_304 0% 11.5% 28.7% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000478424 GAGTTTAGGGGTTTCCTCCTTGGC pLX_317 13.6% 11.5% 28.7% V5 (not translated due to prior stop codon) (many diffs) n/a
4 ccsbBroadEn_12416 pDONR223 100% 11.2% 10.9% None (many diffs) n/a
5 ccsbBroad304_12416 pLX_304 0% 11.2% 10.9% V5 (many diffs) n/a
6 TRCN0000478477 TTATCTGGAGTACACCTTAATACC pLX_317 16.2% 11.2% 10.9% V5 (many diffs) n/a
Download CSV