Transcript: Human NM_001256024.2

Homo sapiens Rho GTPase activating protein 22 (ARHGAP22), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-06-02
Taxon:
Homo sapiens (human)
Gene:
ARHGAP22 (58504)
Length:
2777
CDS:
278..2422

Additional Resources:

NCBI RefSeq record:
NM_001256024.2
NBCI Gene record:
ARHGAP22 (58504)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001256024.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000425820 CAACCTTCCTCAGGCAAATTA pLKO_005 1147 CDS 100% 15.000 21.000 N ARHGAP22 n/a
2 TRCN0000417829 GAAGTTCAGGCATACTCAAAT pLKO_005 1202 CDS 100% 13.200 18.480 N ARHGAP22 n/a
3 TRCN0000047205 CAGGGATTTATTTCTCTACAA pLKO.1 509 CDS 100% 4.950 6.930 N ARHGAP22 n/a
4 TRCN0000047203 GCTCAGATACATCTGCAAGTT pLKO.1 1174 CDS 100% 4.950 6.930 N ARHGAP22 n/a
5 TRCN0000422249 ACAAGATGAGTGTCCAGAATC pLKO_005 1227 CDS 100% 10.800 7.560 N ARHGAP22 n/a
6 TRCN0000424612 GACTCTCCACCTACGACAATG pLKO_005 1788 CDS 100% 10.800 7.560 N ARHGAP22 n/a
7 TRCN0000423083 ATGGAGTTAGAAGCGTCTGTA pLKO_005 2475 3UTR 100% 4.950 3.465 N ARHGAP22 n/a
8 TRCN0000047206 CAGAGGGAAATGGAGGAGTTT pLKO.1 2345 CDS 100% 4.950 3.465 N ARHGAP22 n/a
9 TRCN0000047207 CCACTGTTTGACAGCACAACA pLKO.1 971 CDS 100% 4.950 3.465 N ARHGAP22 n/a
10 TRCN0000181601 GCTAAACAAGTGAGCAACCTT pLKO.1 1133 CDS 100% 3.000 2.100 N Arhgap22 n/a
11 TRCN0000047204 GCTGGAAATAAAGCTGCGGAA pLKO.1 2278 CDS 100% 2.160 1.512 N ARHGAP22 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001256024.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12416 pDONR223 100% 99.9% 100% None 330C>T;639A>G n/a
2 ccsbBroad304_12416 pLX_304 0% 99.9% 100% V5 330C>T;639A>G n/a
3 TRCN0000478477 TTATCTGGAGTACACCTTAATACC pLX_317 16.2% 99.9% 100% V5 330C>T;639A>G n/a
4 ccsbBroadEn_08780 pDONR223 100% 97.4% 37.8% None (many diffs) n/a
5 ccsbBroad304_08780 pLX_304 0% 97.4% 37.8% V5 (not translated due to prior stop codon) (many diffs) n/a
6 TRCN0000478424 GAGTTTAGGGGTTTCCTCCTTGGC pLX_317 13.6% 97.4% 37.8% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV