Transcript: Mouse XM_006506643.3

PREDICTED: Mus musculus membrane-associated ring finger (C3HC4) 8 (March8), transcript variant X6, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
March8 (71779)
Length:
5287
CDS:
430..2073

Additional Resources:

NCBI RefSeq record:
XM_006506643.3
NBCI Gene record:
March8 (71779)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006506643.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000127310 GCAAGGTGTACCTACAGTTAT pLKO.1 1856 CDS 100% 13.200 9.240 N March8 n/a
2 TRCN0000127311 TGCAAGGTGTACCTACAGTTA pLKO.1 1855 CDS 100% 4.950 3.465 N March8 n/a
3 TRCN0000127313 CCATGAGTCATCCAAGCAACA pLKO.1 482 CDS 100% 4.050 2.835 N March8 n/a
4 TRCN0000127309 CCCACATAGATAGGTGGCTTT pLKO.1 4084 3UTR 100% 4.050 2.835 N March8 n/a
5 TRCN0000073236 CTGGTCCTTGTATGTGCTCAT pLKO.1 1710 CDS 100% 4.050 2.835 N MARCHF8 n/a
6 TRCN0000127312 CACTTCTGTCACACCATCCAA pLKO.1 561 CDS 100% 3.000 2.100 N March8 n/a
7 TRCN0000428640 TGAGAAGACTTTGGGACATTT pLKO_005 462 CDS 100% 13.200 10.560 N MARCHF8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006506643.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09862 pDONR223 100% 45% 41.9% None (many diffs) n/a
2 ccsbBroad304_09862 pLX_304 0% 45% 41.9% V5 (many diffs) n/a
3 TRCN0000479403 GACCACTCCAATCGCGGAGAGCCT pLX_317 40.9% 45% 41.9% V5 (many diffs) n/a
Download CSV