Construct: ORF TRCN0000479442
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF018867.2_s317c1
- Derived from:
- ccsbBroadEn_14702
- DNA Barcode:
- CTCCCCGACTCACATGTCCGATAG
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Early stop codon detected
Originally Annotated References:
- Gene:
- MPP3 (4356)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000479442
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 4356 | MPP3 | membrane palmitoylated prot... | NM_001932.5 | 97.3% | 50.5% | (many diffs) |
| 2 | human | 4356 | MPP3 | membrane palmitoylated prot... | XM_006721915.2 | 97.3% | 50.5% | (many diffs) |
| 3 | human | 4356 | MPP3 | membrane palmitoylated prot... | NM_001353080.1 | 96% | 49.8% | (many diffs) |
| 4 | human | 4356 | MPP3 | membrane palmitoylated prot... | NM_001330233.1 | 93.4% | 48.4% | (many diffs) |
| 5 | human | 4356 | MPP3 | membrane palmitoylated prot... | XR_001752516.1 | 75.6% | (many diffs) | |
| 6 | human | 4356 | MPP3 | membrane palmitoylated prot... | XR_002958011.1 | 75.5% | (many diffs) | |
| 7 | human | 4356 | MPP3 | membrane palmitoylated prot... | XR_001752517.2 | 71.5% | (many diffs) | |
| 8 | human | 4356 | MPP3 | membrane palmitoylated prot... | XR_934466.2 | 71.4% | (many diffs) | |
| 9 | human | 4356 | MPP3 | membrane palmitoylated prot... | XR_001752512.2 | 71.2% | (many diffs) | |
| 10 | human | 4356 | MPP3 | membrane palmitoylated prot... | XM_017024656.1 | 62.9% | 16.3% | (many diffs) |
| 11 | human | 4356 | MPP3 | membrane palmitoylated prot... | NR_003562.3 | 60% | (many diffs) | |
| 12 | human | 4356 | MPP3 | membrane palmitoylated prot... | XM_017024657.2 | 58.2% | 11.7% | (many diffs) |
| 13 | human | 4356 | MPP3 | membrane palmitoylated prot... | XR_001752515.1 | 57.6% | (many diffs) | |
| 14 | human | 4356 | MPP3 | membrane palmitoylated prot... | NR_148343.1 | 57.6% | (many diffs) | |
| 15 | human | 4356 | MPP3 | membrane palmitoylated prot... | NR_148342.1 | 54.6% | (many diffs) | |
| 16 | human | 4356 | MPP3 | membrane palmitoylated prot... | NR_148345.1 | 53.7% | (many diffs) | |
| 17 | human | 4356 | MPP3 | membrane palmitoylated prot... | NR_148344.1 | 53% | (many diffs) | |
| 18 | human | 4356 | MPP3 | membrane palmitoylated prot... | XM_017024658.1 | 51.7% | 77% | (many diffs) |
| 19 | human | 4356 | MPP3 | membrane palmitoylated prot... | XM_017024659.1 | 48.5% | 71.7% | (many diffs) |
| 20 | human | 4356 | MPP3 | membrane palmitoylated prot... | XM_006721916.3 | 48.5% | 59.4% | (many diffs) |
| 21 | human | 4356 | MPP3 | membrane palmitoylated prot... | XM_017024655.1 | 48.2% | 59.2% | (many diffs) |
| 22 | human | 4356 | MPP3 | membrane palmitoylated prot... | XM_017024660.1 | 35.3% | 56% | (many diffs) |
| 23 | mouse | 13384 | Mpp3 | membrane protein, palmitoyl... | NM_007863.2 | 85.1% | 48.6% | (many diffs) |
| 24 | mouse | 13384 | Mpp3 | membrane protein, palmitoyl... | XM_006532138.3 | 85.1% | 48.6% | (many diffs) |
| 25 | mouse | 13384 | Mpp3 | membrane protein, palmitoyl... | XM_006532139.3 | 74.8% | 37.3% | (many diffs) |
| 26 | mouse | 13384 | Mpp3 | membrane protein, palmitoyl... | XM_006532140.3 | 47.8% | 79.4% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1092
- ORF length:
- 1023
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gccagtgcta tcggaggact ctggtttgca tgaaaccctg gccctgctga 121 cctcccagct cagacctgac tccaaccaca aggaggagat gggcttcctg agggatgttt 181 tcagtgaaaa aagcctcagt tacttaatga agattcatga gaagcttcgc tattatgaaa 241 ggcaaagtcc aaccccagtt ctgcacagcg ctgtggccct cgctgaggac gtgatggagg 301 agttgcaggc cgcctccgtg cacagtgatg agagggagct gctccagctg ctgtccaccc 361 cgcacctgag ggctgtgctc atggtacatg acacggttgc ccagaagaat tttgaccccg 421 ttctcccgcc tctgcctgac aatatcgatg aggattttga tgaggaatcg gtgaagatcg 481 tccgcttggt gaagaacaag gaacccctgg gtgccaccat ccggcgggac gagcactcag 541 gggctgttgt ggtggccagg atcatgcgag gaggcgcagc agacaggagc ggcctggtcc 601 acgttggaga tgagctccga gaagtgaacg ggatcgcagt cctgcacaag cggcccgacg 661 agatcagcca gattctggcc cagtcccagg gatccatcac cctaaaaatc atcccagcca 721 cccaggagga agatcgctta aaggagagca aggtgttcat gcgcgccctc ttcactacaa 781 ccctcggagg accgggccat cccttgccag gaggcgggcc tgcccttcca gcgcagcagg 841 tcctgggagg tggtggagcc aggacgaccc ccacgttgtt gcaggccaag cgagtcgggg 901 acaccaacct tcgagccggc ctcatcccct ccaaggggtt ccaggagaga cgactaagct 961 accggagagc cgcgggcacc ctgccgagcc cccagagcct caggaagccc cccttagagc 1021 ttgtgactgt gaggctaacc tcaaaaggcc actatgtggc tgttcgtcgg aagagcttcc 1081 cgactgggct gtagggagag actgggtggc tcgcagacag taaagatgtc ttcaggagct 1141 gagtctccct agctgctgac ttacgtagag gtggccaggt accaacacca gcccggagag 1201 cggccccgcc tggtggttct gatcgggtct ctgggagccc gactgcacga gctgaagcaa 1261 aaggtggtgg ctgagaaccc acagcacttt ggcgtcgctg ttccacatac caccaggccc 1321 cgaaagagcc atgagaagga aggagtggaa tatcactttg tgtctaagca agcatttgag 1381 gccgacttac atcacaacaa gttcctggaa catggtgaat ataaggaaaa tctgtatgga 1441 accagcctgg aggccattca ggctgttatg gccaaaaaca aagtttgttt ggtggatgtg 1501 gagccagaag cactgaaaca actgaggacc TCAGAATTTA AACCCTATAT TATATTTGTA 1561 AAGCCTGCAA TTCAGGAAAA AAGAAAAACG CCACCTATGT CCCCAGCTTG TGAGGACACA 1621 GCAGCCCCAT TTGATGAGCA GCAGCAAGAG ATGGCCGCTT CTGCCGCCTT CATAGACCGG 1681 CATTACGGGC ACCTGGTAGA CGCCGTGCTG GTGAAGGAGG ATCTCCAGGG TGCCTACAGC 1741 CAGCTCAAAG TGGTCTTAGA GAAGCTGAGC AAGGACACTC ACTGGGTACC TGTTAGTTGG 1801 GTCAGGTTGC CAACTTTCTT GTACAAAGTG GTTGATATCG GTAAGCCTAT CCCTAACCCT 1861 CTCCTCGGTC TCGATTCTAC GTAGTAATGA ACTAGTCCGT AACTTGAAAG TATTTCGATT 1921 TCTTGGCTTT ATATATCTTG TGGAAAGGAC GACTCCCCGA CTCACATGTC CGATAGACGC 1981 GTTAAGTCga caatcaacct ctggattaca aaatttgtga aagatt