Transcript: Mouse NM_001037727.2

Mus musculus Rho GTPase activating protein 25 (Arhgap25), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-14
Taxon:
Mus musculus (mouse)
Gene:
Arhgap25 (232201)
Length:
3695
CDS:
374..2320

Additional Resources:

NCBI RefSeq record:
NM_001037727.2
NBCI Gene record:
Arhgap25 (232201)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001037727.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000200737 GCAAGGATATTGGCAATCTAA pLKO.1 2850 3UTR 100% 5.625 7.875 N Arhgap25 n/a
2 TRCN0000192525 GATCCAAAGAGTGATGACCAT pLKO.1 1387 CDS 100% 2.640 3.696 N Arhgap25 n/a
3 TRCN0000190509 GCTCTTGTTAGCACAGACTCT pLKO.1 1964 CDS 100% 2.640 2.112 N Arhgap25 n/a
4 TRCN0000190690 GCGGACTTCTACCTACGATAA pLKO.1 1867 CDS 100% 10.800 7.560 N Arhgap25 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001037727.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11434 pDONR223 100% 56.6% 56.2% None (many diffs) n/a
2 ccsbBroad304_11434 pLX_304 0% 56.6% 56.2% V5 (many diffs) n/a
3 TRCN0000479463 TGTCAACTCATTCAAAAGTAGCAC pLX_317 25% 56.6% 56.2% V5 (many diffs) n/a
Download CSV