Transcript: Human NR_134867.2

Homo sapiens glutamine amidotransferase like class 1 domain containing 1 (GATD1), transcript variant 8, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
GATD1 (347862)
Length:
4394
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_134867.2
NBCI Gene record:
GATD1 (347862)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_134867.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000142695 CACTTCCACTCTGAGAGCAAA pLKO.1 285 3UTR 100% 4.950 3.465 N GATD1 n/a
2 TRCN0000141760 GAGCCCAGCATTGAAGATCAA pLKO.1 4063 3UTR 100% 4.950 3.465 N GATD1 n/a
3 TRCN0000122471 GCCCTCTACTTCCTCACAGTT pLKO.1 1544 3UTR 100% 4.950 3.465 N GATD1 n/a
4 TRCN0000141816 GTGGATGTGACTGAGAGCAAT pLKO.1 108 3UTR 100% 4.950 3.465 N GATD1 n/a
5 TRCN0000122291 CCCAAGATGAAAGCACCAGTA pLKO.1 3828 3UTR 100% 4.050 2.835 N GATD1 n/a
6 TRCN0000143864 CCATGGAATTTGTGGATGTGA pLKO.1 97 3UTR 100% 3.000 2.100 N GATD1 n/a
7 TRCN0000141362 CTTTGGGATGTGAAGTGGGTT pLKO.1 4095 3UTR 100% 2.640 1.848 N GATD1 n/a
8 TRCN0000143450 GCATTGAAGATCAAAGCAGGT pLKO.1 4070 3UTR 100% 2.160 1.512 N GATD1 n/a
9 TRCN0000144970 GACCATGAGATTCTCAATGAT pLKO.1 1366 3UTR 100% 5.625 3.375 N GATD1 n/a
10 TRCN0000142618 GATGTGACTGAGAGCAATGCA pLKO.1 111 3UTR 100% 3.000 1.800 N GATD1 n/a
11 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 2027 3UTR 100% 4.950 2.475 Y ERAP2 n/a
12 TRCN0000165027 GAACTCCTGACCTCAAGTGAT pLKO.1 2718 3UTR 100% 4.950 2.475 Y LOC387873 n/a
13 TRCN0000143567 GATCATCTGAAGTCAGGAGTT pLKO.1 2066 3UTR 100% 4.050 2.025 Y GDPD1 n/a
14 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 2028 3UTR 100% 13.200 6.600 Y LIAS n/a
15 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 2889 3UTR 100% 5.625 2.813 Y KLHL30 n/a
16 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 2889 3UTR 100% 5.625 2.813 Y EID2B n/a
17 TRCN0000138772 GCAGGAGAATCGCTTGAACTT pLKO.1 3652 3UTR 100% 4.950 2.475 Y DCAF11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_134867.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13615 pDONR223 100% 13.9% None (many diffs) n/a
2 ccsbBroad304_13615 pLX_304 0% 13.9% V5 (many diffs) n/a
3 TRCN0000479507 CAGGCAAGCGCAATGCGGGTATTA pLX_317 26.5% 13.9% V5 (many diffs) n/a
4 ccsbBroadEn_13781 pDONR223 100% 5.5% None (many diffs) n/a
5 ccsbBroad304_13781 pLX_304 0% 5.5% V5 (many diffs) n/a
6 TRCN0000469746 TCCCTGCGCCGTCCGGGTTTTCGA pLX_317 100% 5.5% V5 (many diffs) n/a
7 ccsbBroadEn_10792 pDONR223 100% 4.9% None (many diffs) n/a
8 ccsbBroad304_10792 pLX_304 0% 4.9% V5 (many diffs) n/a
9 TRCN0000472287 GCCTGGAGAGCTTTCCTCGTCACG pLX_317 100% 4.9% V5 (many diffs) n/a
10 ccsbBroadEn_12783 pDONR223 100% 4.3% None (many diffs) n/a
11 ccsbBroad304_12783 pLX_304 0% 4.3% V5 (many diffs) n/a
12 TRCN0000478282 TATCTGCTCCACCGGGCTCCGTTG pLX_317 100% 4.3% V5 (many diffs) n/a
13 ccsbBroadEn_11616 pDONR223 100% 3.9% None (many diffs) n/a
14 ccsbBroad304_11616 pLX_304 0% 3.9% V5 (many diffs) n/a
15 TRCN0000467678 CCTCCCCTCACACCTCGTCAAAAC pLX_317 100% 3.9% V5 (many diffs) n/a
16 ccsbBroadEn_15487 pDONR223 0% 3.6% None (many diffs) n/a
17 ccsbBroad304_15487 pLX_304 0% 3.6% V5 (many diffs) n/a
18 TRCN0000473708 TAGCATCGTTGCACGCGCACGTTG pLX_317 100% 3.6% V5 (many diffs) n/a
19 ccsbBroadEn_10261 pDONR223 100% 1.4% None (many diffs) n/a
20 ccsbBroad304_10261 pLX_304 0% 1.4% V5 (many diffs) n/a
21 TRCN0000492083 TTATAGGCCCAGAGCACTACCAAC pLX_317 100% 1.4% V5 (many diffs) n/a
Download CSV