Transcript: Human NM_001318824.2

Homo sapiens glutamine amidotransferase like class 1 domain containing 1 (GATD1), transcript variant 7, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
GATD1 (347862)
Length:
4255
CDS:
26..580

Additional Resources:

NCBI RefSeq record:
NM_001318824.2
NBCI Gene record:
GATD1 (347862)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001318824.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000141760 GAGCCCAGCATTGAAGATCAA pLKO.1 3924 3UTR 100% 4.950 3.465 N GATD1 n/a
2 TRCN0000122471 GCCCTCTACTTCCTCACAGTT pLKO.1 1405 3UTR 100% 4.950 3.465 N GATD1 n/a
3 TRCN0000141816 GTGGATGTGACTGAGAGCAAT pLKO.1 185 CDS 100% 4.950 3.465 N GATD1 n/a
4 TRCN0000122291 CCCAAGATGAAAGCACCAGTA pLKO.1 3689 3UTR 100% 4.050 2.835 N GATD1 n/a
5 TRCN0000143864 CCATGGAATTTGTGGATGTGA pLKO.1 174 CDS 100% 3.000 2.100 N GATD1 n/a
6 TRCN0000141415 CTTCCTCCACTGTTTCACGAT pLKO.1 106 CDS 100% 2.640 1.848 N GATD1 n/a
7 TRCN0000141362 CTTTGGGATGTGAAGTGGGTT pLKO.1 3956 3UTR 100% 2.640 1.848 N GATD1 n/a
8 TRCN0000143450 GCATTGAAGATCAAAGCAGGT pLKO.1 3931 3UTR 100% 2.160 1.512 N GATD1 n/a
9 TRCN0000144970 GACCATGAGATTCTCAATGAT pLKO.1 1227 3UTR 100% 5.625 3.375 N GATD1 n/a
10 TRCN0000142618 GATGTGACTGAGAGCAATGCA pLKO.1 188 CDS 100% 3.000 1.800 N GATD1 n/a
11 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 1888 3UTR 100% 4.950 2.475 Y ERAP2 n/a
12 TRCN0000165027 GAACTCCTGACCTCAAGTGAT pLKO.1 2579 3UTR 100% 4.950 2.475 Y LOC387873 n/a
13 TRCN0000143567 GATCATCTGAAGTCAGGAGTT pLKO.1 1927 3UTR 100% 4.050 2.025 Y GDPD1 n/a
14 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 1889 3UTR 100% 13.200 6.600 Y LIAS n/a
15 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 2750 3UTR 100% 5.625 2.813 Y KLHL30 n/a
16 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 2750 3UTR 100% 5.625 2.813 Y EID2B n/a
17 TRCN0000138772 GCAGGAGAATCGCTTGAACTT pLKO.1 3513 3UTR 100% 4.950 2.475 Y DCAF11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001318824.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13615 pDONR223 100% 63.5% 58.9% None (many diffs) n/a
2 ccsbBroad304_13615 pLX_304 0% 63.5% 58.9% V5 (many diffs) n/a
3 TRCN0000479507 CAGGCAAGCGCAATGCGGGTATTA pLX_317 26.5% 63.5% 58.9% V5 (many diffs) n/a
Download CSV