Construct: ORF TRCN0000480126
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF011473.2_s317c1
- Derived from:
- ccsbBroadEn_10876
- DNA Barcode:
- GGTTTAAAAAATATATTGATCTAG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- HLA-C (3107)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000480126
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 3107 | HLA-C | major histocompatibility co... | NM_001243042.1 | 96.6% | 93.1% | (many diffs) |
| 2 | human | 3107 | HLA-C | major histocompatibility co... | NM_002117.6 | 96.6% | 93.1% | (many diffs) |
| 3 | human | 3106 | HLA-B | major histocompatibility co... | NM_005514.8 | 92.4% | 88.2% | (many diffs) |
| 4 | human | 3105 | HLA-A | major histocompatibility co... | NM_002116.8 | 89.1% | 84.1% | (many diffs) |
| 5 | human | 3105 | HLA-A | major histocompatibility co... | NM_001242758.1 | 88.6% | 82.5% | (many diffs) |
| 6 | human | 3133 | HLA-E | major histocompatibility co... | NM_005516.6 | 84.9% | 75.6% | (many diffs) |
| 7 | human | 3133 | HLA-E | major histocompatibility co... | XM_017010809.2 | 83.7% | 72.4% | (many diffs) |
| 8 | human | 3135 | HLA-G | major histocompatibility co... | NM_002127.5 | 82.5% | 76.7% | (many diffs) |
| 9 | human | 3135 | HLA-G | major histocompatibility co... | XM_024446420.1 | 82.5% | 76.7% | (many diffs) |
| 10 | human | 3134 | HLA-F | major histocompatibility co... | NM_018950.2 | 81.6% | 75.6% | (many diffs) |
| 11 | human | 3135 | HLA-G | major histocompatibility co... | NM_001363567.1 | 81.4% | 75.7% | (many diffs) |
| 12 | human | 3134 | HLA-F | major histocompatibility co... | XM_011514564.1 | 80.5% | 74.5% | (many diffs) |
| 13 | human | 3134 | HLA-F | major histocompatibility co... | XM_017010813.1 | 78.2% | 70.8% | (many diffs) |
| 14 | human | 3133 | HLA-E | major histocompatibility co... | XM_017010807.1 | 75.9% | 62.4% | (many diffs) |
| 15 | human | 3133 | HLA-E | major histocompatibility co... | XM_017010808.1 | 75.9% | 62.4% | (many diffs) |
| 16 | human | 3134 | HLA-F | major histocompatibility co... | XM_017010812.1 | 72.4% | 65.4% | (many diffs) |
| 17 | human | 3134 | HLA-F | major histocompatibility co... | XM_017010811.1 | 71.5% | 62.3% | (many diffs) |
| 18 | human | 3134 | HLA-F | major histocompatibility co... | XM_017010810.1 | 70% | 63.2% | (many diffs) |
| 19 | human | 3134 | HLA-F | major histocompatibility co... | NM_001098479.2 | 68.9% | 62.2% | (many diffs) |
| 20 | human | 3135 | HLA-G | major histocompatibility co... | XM_017010817.1 | 59.9% | 55.4% | (many diffs) |
| 21 | human | 3135 | HLA-G | major histocompatibility co... | XM_017010818.1 | 59.9% | 55.4% | (many diffs) |
| 22 | human | 3134 | HLA-F | major histocompatibility co... | NM_001098478.2 | 59.3% | 53.2% | (many diffs) |
| 23 | human | 3136 | HLA-H | major histocompatibility co... | NR_001434.4 | 57.7% | (many diffs) | |
| 24 | human | 3134 | HLA-F | major histocompatibility co... | XM_017010815.1 | 54.3% | 50.5% | (many diffs) |
| 25 | human | 3134 | HLA-F | major histocompatibility co... | XM_017010814.1 | 46.5% | 41.7% | (many diffs) |
| 26 | human | 3134 | HLA-F | major histocompatibility co... | XR_001743373.1 | 29% | (many diffs) | |
| 27 | human | 3134 | HLA-F | major histocompatibility co... | XR_001743374.1 | 27.9% | (many diffs) | |
| 28 | human | 3134 | HLA-F | major histocompatibility co... | XR_001743376.1 | 27.8% | (many diffs) | |
| 29 | human | 3139 | HLA-L | major histocompatibility co... | NR_027822.1 | 16.1% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1164
- ORF length:
- 1098
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgcg ggtcatggcg ccccgaaccc tcatcctgct gctctcggga gccctggccc 121 tgaccgagac ctgggcctgc tcccactcca tgaggtattt ctacaccgcc gtgtcccggc 181 ccggccgcgg agagccccgc ttcatcgcag tgggctacgt ggacgacacg cagttcgtgc 241 ggttcgacag cgacgccgcg agtccaagag gggagccgcg ggcgccgtgg gtggagcagg 301 aggggccgga gtattgggac cgggagacac agaagtacaa gcgccaggca cagactgacc 361 gagtgagcct gcggaacctg cgcggctact acaaccagag cgaggccggg tctcacaccc 421 tccagtggat gtatggctgc gacctggggc ccgacgggcg cctcctccgc gggtatgacc 481 agtccgccta cgacggcaag gattacatcg ccctgaacga ggacctgcgc tcctggaccg 541 ccgcggacac ggcggctcag atcacccagc gcaagtggga ggcggcccgt gcggcggagc 601 agcagagagc ctacctggag ggcacgtgcg tggagtggct ccgcagatac ctggagaacg 661 ggaaggagac gctgcagcgc gcggaacacc caaagacaca cgtgacccac catctcgtct 721 ctgaccatga ggccaccctg aggtgctggg ccctgggcTT CTACCCTGCG GAGATCACAC 781 TGACCTGGCA GCGGGATGGC GAGGACCAAA CTCAGGACAC CGAGCTTGTG GAGACCAGGC 841 CAGCAGGAGA TGGAACCTTC CAGAAGTGGG CAGCTGTGGT GGTGCCTTCT GGAGAAGAGC 901 AGAGATACAC GTGCCATGTG CAGCACGAGG GGCTGCCGGA GCCCCTCACC CTGAGATGGG 961 AGCCATCTTC CCAGCCCACC ATCCCCATCG TGGGCATCGT TGCTGGCCTG GCTGTCCTGG 1021 CTGTCCTAGC TGTCCTAGGA GCTGTGGTGG CTGTTGTTAT GTGTAGGAGG AAGAGCTCAG 1081 GTGGAAAAGG AGGGAGCTGC TCTCAGGCTG CGTCCAGCAA CAGTGCCCAG GGCTCTGATG 1141 AGTCTCTCAT CGCTTGTAAA GCCTGCCCAA CTTTCTTGTA CAAAGTGGTT GATATCGGTA 1201 AGCCTATCCC TAACCCTCTC CTCGGTCTCG ATTCTACGTA GTAATGAACT AGTCCGTAAC 1261 TTGAAAGTAT TTCGATTTCT TGGCTTTATA TATCTTGTGG AAAGGACGAG GTTTAAAAAA 1321 TATATTGATC TAGACGCGTT AAGTCgacaa tcaacctctg gattacaaaa tttgtgaaag 1381 att