Transcript: Mouse XM_017318119.1

PREDICTED: Mus musculus transcription factor 7 like 2, T cell specific, HMG box (Tcf7l2), transcript variant X19, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tcf7l2 (21416)
Length:
4239
CDS:
557..1993

Additional Resources:

NCBI RefSeq record:
XM_017318119.1
NBCI Gene record:
Tcf7l2 (21416)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017318119.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000374009 TGGCCGAATGCACATTGAAAG pLKO_005 1650 CDS 100% 10.800 15.120 N Tcf7l2 n/a
2 TRCN0000012179 GCTCCGAAAGTTTCCGAGATA pLKO.1 768 CDS 100% 4.950 3.960 N Tcf7l2 n/a
3 TRCN0000421340 CAAGATGGAGGGCTCTTTAAG pLKO_005 824 CDS 100% 13.200 9.240 N Tcf7l2 n/a
4 TRCN0000321291 CCAGATATCTCTCCATATTAC pLKO_005 1265 CDS 100% 13.200 9.240 N Tcf7l2 n/a
5 TRCN0000012178 CCTTAGCGTAAGCATCTTATA pLKO.1 3218 3UTR 100% 13.200 9.240 N Tcf7l2 n/a
6 TRCN0000378996 CGCCGTGGCTACATGAGTTAA pLKO_005 2547 3UTR 100% 13.200 9.240 N Tcf7l2 n/a
7 TRCN0000321293 TATGGAGTTCATTGGTCAATA pLKO_005 2572 3UTR 100% 13.200 9.240 N Tcf7l2 n/a
8 TRCN0000416397 ACGAGCTGATCTCCTTCAAAG pLKO_005 603 CDS 100% 10.800 7.560 N Tcf7l2 n/a
9 TRCN0000321292 GGTCTGCACGGGATAACTATG pLKO_005 1794 CDS 100% 10.800 7.560 N Tcf7l2 n/a
10 TRCN0000012180 GCTGACAGTCAACGCATCTAT pLKO.1 1393 CDS 100% 5.625 3.938 N Tcf7l2 n/a
11 TRCN0000321290 GCTGACAGTCAACGCATCTAT pLKO_005 1393 CDS 100% 5.625 3.938 N Tcf7l2 n/a
12 TRCN0000012182 CCCTCCAGATATCTCTCCATA pLKO.1 1261 CDS 100% 4.950 3.465 N Tcf7l2 n/a
13 TRCN0000012181 GTTTCCTAAATCCTTGCCTTT pLKO.1 1875 CDS 100% 4.050 2.835 N Tcf7l2 n/a
14 TRCN0000282444 CTCCGCACCCTCCAGATATAT pLKO_005 1254 CDS 100% 15.000 10.500 N TCF7L2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017318119.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000480255 GCCTCGCGGCGTGACGATTTCTTC pLX_317 23% 83.7% 87.4% V5 (many diffs) n/a
2 ccsbBroadEn_01651 pDONR223 100% 83.1% 87.4% None (many diffs) n/a
3 ccsbBroad304_01651 pLX_304 49.6% 83.1% 87.4% V5 (many diffs) n/a
Download CSV