Construct: ORF TRCN0000480311
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF018915.4_s317c1
- Derived from:
- ccsbBroadEn_14718
- DNA Barcode:
- ACGACTGCCTGATAGCATTACTAG
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Early stop codon detected
Originally Annotated References:
- Gene:
- NPR2 (4882)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000480311
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 4882 | NPR2 | natriuretic peptide receptor 2 | NM_003995.3 | 93.8% | 19.6% | (many diffs) |
| 2 | human | 4882 | NPR2 | natriuretic peptide receptor 2 | XM_005251478.3 | 93.5% | 19.6% | (many diffs) |
| 3 | human | 4882 | NPR2 | natriuretic peptide receptor 2 | XM_024447557.1 | 89.3% | 18.7% | (many diffs) |
| 4 | human | 4882 | NPR2 | natriuretic peptide receptor 2 | XM_024447556.1 | 89% | 18.7% | (many diffs) |
| 5 | human | 4882 | NPR2 | natriuretic peptide receptor 2 | XM_024447558.1 | 59.5% | 3.5% | (many diffs) |
| 6 | human | 4882 | NPR2 | natriuretic peptide receptor 2 | XM_024447561.1 | 49.4% | 4.5% | (many diffs) |
| 7 | human | 4882 | NPR2 | natriuretic peptide receptor 2 | XM_024447560.1 | 47% | 4.2% | (many diffs) |
| 8 | human | 4882 | NPR2 | natriuretic peptide receptor 2 | XM_024447559.1 | 46.9% | 4.2% | (many diffs) |
| 9 | mouse | 230103 | Npr2 | natriuretic peptide receptor 2 | NM_173788.4 | 86.8% | 19.2% | (many diffs) |
| 10 | mouse | 230103 | Npr2 | natriuretic peptide receptor 2 | NM_001355466.1 | 84.4% | 19.6% | (many diffs) |
| 11 | mouse | 230103 | Npr2 | natriuretic peptide receptor 2 | XR_390318.4 | 41.4% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 768
- ORF length:
- 699
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat ggcgctgcca tcacttctgc tgttggtggc agccctggca ggtggggtgc 121 gtcctcccgg ggcgcggaac ctgacgctgg cggtggtgct gccagaacac aacctgagct 181 atgcctgggc ctggccacgg gtgggacccg ctgtggcact agctgtggag gctctgggcc 241 gggcactgcc cgtggacctg cggtttgtca gctccgaact ggaaggcgcc tgctctgagt 301 acctggcacc gctgagcgct gtggacctca agctgtacca tgaccccgac ctgctgttag 361 gtcccggttg cgtgtaccct gctgcctctg tggcccgctt tgcctcccac tggcgccttc 421 ccctgctgac tgcgggtgct gtggcctctg gtttttcggc taagaatgac cattatcgta 481 ccctggttcg cactggcccc tctgctccca agctgggtga gtttgtggtg acactacacg 541 ggcacttcaa ttggactgcc cgtgctgcct tgctgtacct ggatgctcgc acagatgacc 601 ggcctcacta cttcaccatc gagggcgtct ttgaggccct gcagggcagc aacctcagtg 661 tgcagcacca gtgtatgccc gagagccagg ggccccgagc aggccaccca cttcatccgg 721 gccaacgggc gcattgtgta tatctgcggc cctctggaga tgctgcatga gatcctgctt 781 cagcccagag ggagaatctg accaatgggg attatgttct tcttttacct ggatgtcttt 841 ggggagagtc tccgtgcagg ccccaccacg tgctaacagg ccggccctgg caggacaatc 901 gcacccggga acaggcccag gccctcagag aggcctttca gactgtattg gtgatcacgt 961 accgagaacc cccaaatcct gagtatcagg aattccagaa tcgtctgctg ataagagccc 1021 gggaagactt tggtgtggag ctgggccctt ccctgatgaa cctcatcgct ggctgcttct 1081 atgatgggat cctgctatat gctgaagtcc tgaatgagac aatacaggaa ggaggcaccc 1141 gggaggatgg acttcgaatt gtggaaaaga tgcagggacg aagatatcac ggtgtaactg 1201 ggctggttgt catggacaag aacaatgacc gagagactga ctttgtcctc tgggccatgg 1261 gagacctgga ttctggggac tttcagcctg cagcccacta ctcgggagct gagaagcaga 1321 tttggtggac gggacggcct attccctggg tgaagggggc tcctccctcg gacaatcccc 1381 cctgtgcctt tgacttggac gacccatcct gtgataaaac tccactttca accctggcaa 1441 ttgtggctct gggcacagga atcaccttca tcatgtttgg tgtttccagc ttcctaattt 1501 tccgaaagct gatgctggag aaggagctgg ctagcatgtt gtggcgtatt cgctgggaag 1561 aactgcagtt tggcaactca gagcgttatc acaaaggtgc aggcagtcgc ctcacactgt 1621 cgctgcgggg atccagttac ggctcgctca tgacagccca tgggaaatac cagatctttg 1681 ccaacaccgg tcacttcaag ggaaatgttg tcgccatcaa acatgtgaat aagaagcgca 1741 ttgagctgac ccggcaggtt ctgtttgaac tcaaacatat gagagatgtt cagttcaacc 1801 atctcactcg cttcattggc gcctgcatag accctcccaa catttgcatt gtcactgaat 1861 actgtcctcg tgggagttta caggatattc tagaaaatga cagcatcaac ttggactgga 1921 tgtttcgtta ttcactcatt aatgaccttg ttaagggcat ggcctttctc cacaacagca 1981 ttatttcatc gcatgggagt ctcaagtcct ccaactgtgt ggtggatagt cgttttgtgc 2041 tcaaaatcac agactatggc ctggccagct tccgatcaac tgctgaacct gatgacagcc 2101 atgccctcta tgccaagaag ctgtggactg ccccagaact gctcagtggg aaccccttgc 2161 caaccacagg catgcagaag gctgacgtct atagctttgg gatcatcctg caggagatag 2221 cacttcgcag tggtcctttc tacttggagg gcctggacct cagccccaaa gagatgttcc 2281 agaaggtacg caaatggtca gcggtcccta tttccggggc aagcatcgac cggacccaac 2341 ctcatggaag agcatgttct gtgatcgagt cgatgttaga ctcagaccgc agatgagcga 2401 ccagactttg gacagattaa gcgcttcatt cggcgtctga actagcaggt tggcacccgc 2461 atagtggaca acctcctgct gcgcatggaa cagtatccca ataactcgga gaagatggtg 2521 gaggtacgca cacaggccta tctggaggaa acacgcaagg ctgaagctct cctctaccaa 2581 ctcctacccc attcagtggc agagcagtta acacggggag agactgtaca ggctgaggcc 2641 tttgacactg ttaccatcta cttcagtgac attgtctGGC TTCACAGCAT TGTCAGCAGA 2701 GAGCACCCCC ATGCAGGTAG TGACACTTCT TAATGACCTG TATACCTGCT TTGATGCCAT 2761 AATTGACAAC TTTGATGTCT ACAAGTCTCC ACCTTTCCCA GACTCTCCCA ACCTGTTTCT 2821 TCTCAAAGGG CCAGTCTGTG CTGGGGTTGT TGGCCTGAAG ATGCCCCGTT ATTGTCTTTT 2881 TGGAGACACA GTGAACACTG CTTCTCGAAT GGAGTCTAAT GGTCAAGCGC TGAAGATCCA 2941 TGTCTCCTCT ACCACCAAGG ATGCCCTAGA TGAGCTAGGA TGCTTCCAGC TAGAGCTTCG 3001 GGGGGATGTG GAAATGAAGG GAAAAGGAAA GATGCGAACA TACTGGCTCT TAGGAGAGCG 3061 GAAAGGACCT CCTGGACTCC TGTTGCCAAC TTTCTTGTAC AAAGTGGTTG ATATCGGTAA 3121 GCCTATCCCT AACCCTCTCC TCGGTCTCGA TTCTACGTAG TAATGAACTA GTCCGTAACT 3181 TGAAAGTATT TCGATTTCTT GGCTTTATAT ATCTTGTGGA AAGGACGAAC GACTGCCTGA 3241 TAGCATTACT AGACGCGTTA AGTCgacaat caacctctgg attacaaaat ttgtgaaaga 3301 tt