Transcript: Mouse NM_153089.4

Mus musculus protein phosphatase 1, regulatory (inhibitor) subunit 16B (Ppp1r16b), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Ppp1r16b (228852)
Length:
6370
CDS:
193..1899

Additional Resources:

NCBI RefSeq record:
NM_153089.4
NBCI Gene record:
Ppp1r16b (228852)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_153089.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000103623 CCCTGATTTGTGCAATGAGGA pLKO.1 471 CDS 100% 2.640 2.112 N Ppp1r16b n/a
2 TRCN0000103624 CCTGATTTGTGCAATGAGGAT pLKO.1 472 CDS 100% 2.640 2.112 N Ppp1r16b n/a
3 TRCN0000103621 CCAACCTATACCGGAAAGAAT pLKO.1 1256 CDS 100% 5.625 3.938 N Ppp1r16b n/a
4 TRCN0000103622 CCTTGATTGGAGGCAGAACTT pLKO.1 1751 CDS 100% 4.950 3.465 N Ppp1r16b n/a
5 TRCN0000103620 GCACTTGGTAAAGGCTTCTTA pLKO.1 2177 3UTR 100% 5.625 3.375 N Ppp1r16b n/a
6 TRCN0000166364 CACACACACACACACACACAA pLKO.1 2221 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_153089.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07980 pDONR223 100% 89.8% 96.3% None (many diffs) n/a
2 ccsbBroad304_07980 pLX_304 0% 89.8% 96.3% V5 (many diffs) n/a
3 TRCN0000480319 ACCTTTCTTGTTACCCCCAAACTA pLX_317 20.6% 89.8% 96.3% V5 (many diffs) n/a
Download CSV