Construct: ORF TRCN0000480362
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF003416.1_s317c1
- Derived from:
- ccsbBroadEn_15011
- DNA Barcode:
- CGCGGTTCCATCATTTCCACACCC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- SIK3 (23387)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000480362
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 23387 | SIK3 | SIK family kinase 3 | XM_017017427.1 | 53.4% | 52.6% | (many diffs) |
2 | human | 23387 | SIK3 | SIK family kinase 3 | XM_005271485.3 | 50.1% | 49.3% | (many diffs) |
3 | human | 23387 | SIK3 | SIK family kinase 3 | XM_011542723.2 | 31.9% | 31.4% | (many diffs) |
4 | human | 23387 | SIK3 | SIK family kinase 3 | XM_011542724.2 | 31.9% | 31.4% | (many diffs) |
5 | human | 23387 | SIK3 | SIK family kinase 3 | XM_011542725.2 | 31.9% | 31.4% | (many diffs) |
6 | human | 23387 | SIK3 | SIK family kinase 3 | XM_017017425.1 | 31.9% | 31.4% | (many diffs) |
7 | human | 23387 | SIK3 | SIK family kinase 3 | XM_017017426.1 | 31.9% | 31.4% | (many diffs) |
8 | human | 23387 | SIK3 | SIK family kinase 3 | NM_025164.6 | 29.2% | 28.7% | (many diffs) |
9 | human | 23387 | SIK3 | SIK family kinase 3 | XM_005271482.4 | 29.2% | 28.7% | (many diffs) |
10 | human | 23387 | SIK3 | SIK family kinase 3 | NM_001366686.2 | 28.2% | 27.7% | (many diffs) |
11 | human | 23387 | SIK3 | SIK family kinase 3 | NM_001281748.3 | 28% | 27.5% | (many diffs) |
12 | human | 23387 | SIK3 | SIK family kinase 3 | XM_017017424.1 | 25.6% | 25.1% | (many diffs) |
13 | human | 23387 | SIK3 | SIK family kinase 3 | NM_001281749.3 | 24.6% | 24.2% | (many diffs) |
14 | human | 23387 | SIK3 | SIK family kinase 3 | XM_005271484.3 | 24.6% | 24.2% | (many diffs) |
15 | human | 23387 | SIK3 | SIK family kinase 3 | XM_011542722.1 | 23.8% | 23.3% | (many diffs) |
16 | mouse | 70661 | Sik3 | SIK family kinase 3 | XM_006510590.2 | 25.6% | 25% | (many diffs) |
17 | mouse | 70661 | Sik3 | SIK family kinase 3 | NM_027498.3 | 24.7% | 24.2% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1236
- ORF length:
- 1170
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgca gcagcctgct cagtcacagc aggtcaccat ccaagtccaa gagcctgttg 121 acatgctcag caacatgcca ggcacagctg caggctccag tgggcgcggc atctccatca 181 gccccagtgc tggtcagatg cagatgcagc accgtaccaa cctgatggcc accctcagct 241 atgggcaccg tcccttgtcc aagcagctga gtgctgacag tgcagaggct cacagcttga 301 acgtgaatcg gttctcccct gctaactacg accaggcgca tttacacccc catctgtttt 361 cggaccagtc ccggggttcc cccagcagct acagcccttc aacaggagtg gggttctctc 421 caacccaagc cctgaaagtc cctccacttg accaattccc caccttccct cccagtgcac 481 atcagcagcc gccacactat accacgtcgg cactacagca ggccctgctg tctcccacgc 541 cgccagacta tacaagacac cagcaggtac cccacatcct tcaaggactg ctttctcccc 601 ggcattcgct caccggccac tcggacatcc ggctgccccc aacagagttt gcacagctca 661 ttaaaaggca gcagcaacaa cggcagcagc agcagcaaca gcagcaacag caagaatacc 721 aggaactgtt caggcacatg aaccaagggg atgcggggag tctggctccc agccttgggg 781 gacagagcat gacagagcgc caggctttat cttatcaaaa tgctgactct tatcaccatc 841 acaccagccc ccagcatcTG CTACAAATCA GGGCACAAGA ATGTGTCTCA CAGGCTTCCT 901 CACCCACCCC GCCCCACGGG TATGCTCACC AGCCGGCACT GATGCATTCA GAGAGCATGG 961 AGGAGGACTG CTCGTGTGAG GGGGCCAAGG ATGGCTTCCA AGACAGTAAG AGTTCAAGTA 1021 CATTGACCAA AGGTTGCCAT GACAGCCCTC TGCTCTTGAG TACCGGTGGA CCTGGGGACC 1081 CTGAATCTTT GCTAGGAACT GTGAGTCATG CCCAAGAATT GGGGATACAT CCCTATGGTC 1141 ATCAGCCAAC TGCTGCATTC AGTAAAAATA AGGTGCCCAG CAGAGGTAAG TGTCTCCTCA 1201 CAGTGGAAGT CCTGGGCCAG TCTGCCCTAA TCAACTGCCC AACTTTCTTG TACAAAGTGG 1261 TTGATATCGG TAAGCCTATC CCTAACCCTC TCCTCGGTCT CGATTCTACG TAGTAATGAA 1321 CTAGTCCGTA ACTTGAAAGT ATTTCGATTT CTTGGCTTTA TATATCTTGT GGAAAGGACG 1381 ACGCGGTTCC ATCATTTCCA CACCCACGCG TTAAGTCgac aatcaacctc tggattacaa 1441 aatttgtgaa agatt