Transcript: Human NM_001281749.3

Homo sapiens SIK family kinase 3 (SIK3), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-06-02
Taxon:
Homo sapiens (human)
Gene:
SIK3 (23387)
Length:
6032
CDS:
14..3799

Additional Resources:

NCBI RefSeq record:
NM_001281749.3
NBCI Gene record:
SIK3 (23387)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001144776 GCAGATTGATGAAAGAACCC pXPR_003 TGG 2008 53% 16 0.9102 SIK3 SIK3 75754
2 BRDN0001149197 GCTGCTGAAAGATTGCACTG pXPR_003 CGG 2324 61% 19 0.3769 SIK3 SIK3 75757
3 BRDN0001148836 TGTGCTTCCATCAAATGGCA pXPR_003 GGG 784 21% 6 0.3583 SIK3 SIK3 75756
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001281749.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000196411 GCATACGCAGTAGCTATTATT pLKO.1 5216 3UTR 100% 15.000 21.000 N SIK3 n/a
2 TRCN0000195730 CTACGTGTATTACAGACATTC pLKO.1 3723 CDS 100% 10.800 15.120 N SIK3 n/a
3 TRCN0000037452 GCCAGGCTTTATCTTATCAAA pLKO.1 2958 CDS 100% 5.625 7.875 N SIK3 n/a
4 TRCN0000298761 GCCAGGCTTTATCTTATCAAA pLKO_005 2958 CDS 100% 5.625 7.875 N SIK3 n/a
5 TRCN0000079130 CGCACGGAAGTTATGGAAGAT pLKO.1 1295 CDS 100% 4.950 6.930 N Sik3 n/a
6 TRCN0000037450 CGGAACATTGTTCATCGTGAT pLKO.1 557 CDS 100% 4.050 5.670 N SIK3 n/a
7 TRCN0000298760 CGGAACATTGTTCATCGTGAT pLKO_005 557 CDS 100% 4.050 5.670 N SIK3 n/a
8 TRCN0000037449 CCCAACTTTGACAGGTTAATA pLKO.1 983 CDS 100% 15.000 10.500 N SIK3 n/a
9 TRCN0000310101 GAAGCATTGGTGCGCTATTTG pLKO_005 1238 CDS 100% 13.200 9.240 N SIK3 n/a
10 TRCN0000037451 GCTATCCATCTACGTGTATTA pLKO.1 3714 CDS 100% 13.200 9.240 N SIK3 n/a
11 TRCN0000295926 TTTCTTCCAGAGGTGATATAC pLKO_005 4119 3UTR 100% 13.200 9.240 N SIK3 n/a
12 TRCN0000037453 CCTTCAAAGCTCACCTGGAAA pLKO.1 1914 CDS 100% 4.950 3.465 N SIK3 n/a
13 TRCN0000197263 GCTACAAATCAGGGCACAAGA pLKO.1 3019 CDS 100% 4.950 3.465 N SIK3 n/a
14 TRCN0000196980 GCCATCCTCTGGAATCCTAAT pLKO.1 4315 3UTR 100% 10.800 6.480 N SIK3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001281749.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489060 TGCGAAAACAAGTACTTATGAAAC pLX_317 9.1% 87.6% 87.7% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000489043 TCTGGAAATAATCATTAATACTGA pLX_317 9% 84.3% 84.2% V5 (not translated due to prior stop codon) (many diffs) n/a
3 ccsbBroadEn_15759 pDONR223 0% 24.6% 24.2% None (many diffs) n/a
4 ccsbBroad304_15759 pLX_304 0% 24.6% 24.2% V5 (many diffs) n/a
5 TRCN0000492033 CGACTAGGGCTCCACACATTATGC pLX_317 32.6% 24.6% 24.2% V5 (many diffs) n/a
6 ccsbBroadEn_15011 pDONR223 0% 24.6% 24.2% None (many diffs) n/a
7 ccsbBroad304_15011 pLX_304 0% 24.6% 24.2% V5 (many diffs) n/a
8 TRCN0000480362 CGCGGTTCCATCATTTCCACACCC pLX_317 32.6% 24.6% 24.2% V5 (many diffs) n/a
Download CSV