Transcript: Mouse XM_006510590.2

PREDICTED: Mus musculus SIK family kinase 3 (Sik3), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Sik3 (70661)
Length:
6105
CDS:
1..3966

Additional Resources:

NCBI RefSeq record:
XM_006510590.2
NBCI Gene record:
Sik3 (70661)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006510590.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000295925 ACTACGACCAGGCGCATTTAC pLKO_005 2651 CDS 100% 13.200 18.480 N SIK3 n/a
2 TRCN0000363412 ACTACGACCAGGCGCATTTAC pLKO_005 2651 CDS 100% 13.200 18.480 N Sik3 n/a
3 TRCN0000363470 GAATATCGTTCATCGTGATTT pLKO_005 546 CDS 100% 13.200 18.480 N Sik3 n/a
4 TRCN0000079128 CGAGGGACATTTGCCATGTTT pLKO.1 4129 3UTR 100% 5.625 7.875 N Sik3 n/a
5 TRCN0000079131 CGGAATATCGTTCATCGTGAT pLKO.1 544 CDS 100% 4.050 5.670 N Sik3 n/a
6 TRCN0000037453 CCTTCAAAGCTCACCTGGAAA pLKO.1 1901 CDS 100% 4.950 3.960 N SIK3 n/a
7 TRCN0000079130 CGCACGGAAGTTATGGAAGAT pLKO.1 1426 CDS 100% 4.950 3.960 N Sik3 n/a
8 TRCN0000037449 CCCAACTTTGACAGGTTAATA pLKO.1 970 CDS 100% 15.000 10.500 N SIK3 n/a
9 TRCN0000079132 GCTGGTGTTAGATCCAAATAA pLKO.1 891 CDS 100% 15.000 10.500 N Sik3 n/a
10 TRCN0000363441 AGATCGTCACAGCGGTGTATT pLKO_005 512 CDS 100% 13.200 9.240 N Sik3 n/a
11 TRCN0000079129 GCCACCACGTTCAGTAGAAAT pLKO.1 3478 CDS 100% 13.200 9.240 N Sik3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006510590.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489043 TCTGGAAATAATCATTAATACTGA pLX_317 9% 84.7% 87.6% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000489060 TGCGAAAACAAGTACTTATGAAAC pLX_317 9.1% 81.5% 84.3% V5 (not translated due to prior stop codon) (many diffs) n/a
3 ccsbBroadEn_15759 pDONR223 0% 25.6% 25% None (many diffs) n/a
4 ccsbBroad304_15759 pLX_304 0% 25.6% 25% V5 (many diffs) n/a
5 TRCN0000492033 CGACTAGGGCTCCACACATTATGC pLX_317 32.6% 25.6% 25% V5 (many diffs) n/a
6 ccsbBroadEn_15011 pDONR223 0% 25.6% 25% None (many diffs) n/a
7 ccsbBroad304_15011 pLX_304 0% 25.6% 25% V5 (many diffs) n/a
8 TRCN0000480362 CGCGGTTCCATCATTTCCACACCC pLX_317 32.6% 25.6% 25% V5 (many diffs) n/a
Download CSV