Transcript: Human XM_017017426.1

PREDICTED: Homo sapiens SIK family kinase 3 (SIK3), transcript variant X9, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SIK3 (23387)
Length:
6288
CDS:
428..4060

Additional Resources:

NCBI RefSeq record:
XM_017017426.1
NBCI Gene record:
SIK3 (23387)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017017426.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000196411 GCATACGCAGTAGCTATTATT pLKO.1 5477 3UTR 100% 15.000 21.000 N SIK3 n/a
2 TRCN0000295925 ACTACGACCAGGCGCATTTAC pLKO_005 2745 CDS 100% 13.200 18.480 N SIK3 n/a
3 TRCN0000363412 ACTACGACCAGGCGCATTTAC pLKO_005 2745 CDS 100% 13.200 18.480 N Sik3 n/a
4 TRCN0000194845 CAGATGCCTATGATCACTATA pLKO.1 1056 CDS 100% 13.200 18.480 N SIK3 n/a
5 TRCN0000195730 CTACGTGTATTACAGACATTC pLKO.1 3984 CDS 100% 10.800 15.120 N SIK3 n/a
6 TRCN0000037452 GCCAGGCTTTATCTTATCAAA pLKO.1 3219 CDS 100% 5.625 7.875 N SIK3 n/a
7 TRCN0000298761 GCCAGGCTTTATCTTATCAAA pLKO_005 3219 CDS 100% 5.625 7.875 N SIK3 n/a
8 TRCN0000079130 CGCACGGAAGTTATGGAAGAT pLKO.1 1376 CDS 100% 4.950 6.930 N Sik3 n/a
9 TRCN0000037450 CGGAACATTGTTCATCGTGAT pLKO.1 494 CDS 100% 4.050 5.670 N SIK3 n/a
10 TRCN0000298760 CGGAACATTGTTCATCGTGAT pLKO_005 494 CDS 100% 4.050 5.670 N SIK3 n/a
11 TRCN0000037449 CCCAACTTTGACAGGTTAATA pLKO.1 920 CDS 100% 15.000 10.500 N SIK3 n/a
12 TRCN0000195693 CCTGCTGTGTGATCGACATAA pLKO.1 1090 CDS 100% 13.200 9.240 N SIK3 n/a
13 TRCN0000310101 GAAGCATTGGTGCGCTATTTG pLKO_005 1319 CDS 100% 13.200 9.240 N SIK3 n/a
14 TRCN0000037451 GCTATCCATCTACGTGTATTA pLKO.1 3975 CDS 100% 13.200 9.240 N SIK3 n/a
15 TRCN0000295926 TTTCTTCCAGAGGTGATATAC pLKO_005 4380 3UTR 100% 13.200 9.240 N SIK3 n/a
16 TRCN0000195658 CTCACAGCTTGAACGTGAATC pLKO.1 2709 CDS 100% 10.800 7.560 N SIK3 n/a
17 TRCN0000037453 CCTTCAAAGCTCACCTGGAAA pLKO.1 1995 CDS 100% 4.950 3.465 N SIK3 n/a
18 TRCN0000197263 GCTACAAATCAGGGCACAAGA pLKO.1 3280 CDS 100% 4.950 3.465 N SIK3 n/a
19 TRCN0000196980 GCCATCCTCTGGAATCCTAAT pLKO.1 4576 3UTR 100% 10.800 6.480 N SIK3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017017426.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489060 TGCGAAAACAAGTACTTATGAAAC pLX_317 9.1% 92.1% 92.1% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000489043 TCTGGAAATAATCATTAATACTGA pLX_317 9% 88.6% 88.5% V5 (not translated due to prior stop codon) 0_1ins303;1331_1474del n/a
3 ccsbBroadEn_15759 pDONR223 0% 31.9% 31.4% None (many diffs) n/a
4 ccsbBroad304_15759 pLX_304 0% 31.9% 31.4% V5 (many diffs) n/a
5 TRCN0000492033 CGACTAGGGCTCCACACATTATGC pLX_317 32.6% 31.9% 31.4% V5 (many diffs) n/a
6 ccsbBroadEn_15011 pDONR223 0% 31.9% 31.4% None (many diffs) n/a
7 ccsbBroad304_15011 pLX_304 0% 31.9% 31.4% V5 (many diffs) n/a
8 TRCN0000480362 CGCGGTTCCATCATTTCCACACCC pLX_317 32.6% 31.9% 31.4% V5 (many diffs) n/a
Download CSV