Transcript: Human XM_005271484.3

PREDICTED: Homo sapiens SIK family kinase 3 (SIK3), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SIK3 (23387)
Length:
6057
CDS:
39..3824

Additional Resources:

NCBI RefSeq record:
XM_005271484.3
NBCI Gene record:
SIK3 (23387)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005271484.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000196411 GCATACGCAGTAGCTATTATT pLKO.1 5241 3UTR 100% 15.000 21.000 N SIK3 n/a
2 TRCN0000194845 CAGATGCCTATGATCACTATA pLKO.1 1144 CDS 100% 13.200 18.480 N SIK3 n/a
3 TRCN0000195730 CTACGTGTATTACAGACATTC pLKO.1 3748 CDS 100% 10.800 15.120 N SIK3 n/a
4 TRCN0000037452 GCCAGGCTTTATCTTATCAAA pLKO.1 2983 CDS 100% 5.625 7.875 N SIK3 n/a
5 TRCN0000298761 GCCAGGCTTTATCTTATCAAA pLKO_005 2983 CDS 100% 5.625 7.875 N SIK3 n/a
6 TRCN0000079130 CGCACGGAAGTTATGGAAGAT pLKO.1 1464 CDS 100% 4.950 6.930 N Sik3 n/a
7 TRCN0000037450 CGGAACATTGTTCATCGTGAT pLKO.1 582 CDS 100% 4.050 5.670 N SIK3 n/a
8 TRCN0000298760 CGGAACATTGTTCATCGTGAT pLKO_005 582 CDS 100% 4.050 5.670 N SIK3 n/a
9 TRCN0000037449 CCCAACTTTGACAGGTTAATA pLKO.1 1008 CDS 100% 15.000 10.500 N SIK3 n/a
10 TRCN0000195693 CCTGCTGTGTGATCGACATAA pLKO.1 1178 CDS 100% 13.200 9.240 N SIK3 n/a
11 TRCN0000310101 GAAGCATTGGTGCGCTATTTG pLKO_005 1407 CDS 100% 13.200 9.240 N SIK3 n/a
12 TRCN0000037451 GCTATCCATCTACGTGTATTA pLKO.1 3739 CDS 100% 13.200 9.240 N SIK3 n/a
13 TRCN0000295926 TTTCTTCCAGAGGTGATATAC pLKO_005 4144 3UTR 100% 13.200 9.240 N SIK3 n/a
14 TRCN0000037453 CCTTCAAAGCTCACCTGGAAA pLKO.1 1939 CDS 100% 4.950 3.465 N SIK3 n/a
15 TRCN0000197263 GCTACAAATCAGGGCACAAGA pLKO.1 3044 CDS 100% 4.950 3.465 N SIK3 n/a
16 TRCN0000196980 GCCATCCTCTGGAATCCTAAT pLKO.1 4340 3UTR 100% 10.800 6.480 N SIK3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005271484.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489043 TCTGGAAATAATCATTAATACTGA pLX_317 9% 91% 91% V5 (not translated due to prior stop codon) 1_174del;2618_2619ins180 n/a
2 TRCN0000489060 TGCGAAAACAAGTACTTATGAAAC pLX_317 9.1% 87.6% 87.6% V5 (not translated due to prior stop codon) (many diffs) n/a
3 ccsbBroadEn_15759 pDONR223 0% 24.6% 24.2% None (many diffs) n/a
4 ccsbBroad304_15759 pLX_304 0% 24.6% 24.2% V5 (many diffs) n/a
5 TRCN0000492033 CGACTAGGGCTCCACACATTATGC pLX_317 32.6% 24.6% 24.2% V5 (many diffs) n/a
6 ccsbBroadEn_15011 pDONR223 0% 24.6% 24.2% None (many diffs) n/a
7 ccsbBroad304_15011 pLX_304 0% 24.6% 24.2% V5 (many diffs) n/a
8 TRCN0000480362 CGCGGTTCCATCATTTCCACACCC pLX_317 32.6% 24.6% 24.2% V5 (many diffs) n/a
Download CSV