Transcript: Human XM_011537519.1

PREDICTED: Homo sapiens transcription factor Dp-1 (TFDP1), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TFDP1 (7027)
Length:
2729
CDS:
378..1523

Additional Resources:

NCBI RefSeq record:
XM_011537519.1
NBCI Gene record:
TFDP1 (7027)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011537519.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000019879 CCGCTTATTTGCCGTGAGTTT pLKO.1 1906 3UTR 100% 4.950 3.960 N TFDP1 n/a
2 TRCN0000285159 CCGCTTATTTGCCGTGAGTTT pLKO_005 1906 3UTR 100% 4.950 3.960 N TFDP1 n/a
3 TRCN0000274179 TTCCACGTCTAACGGCACAAG pLKO_005 1343 CDS 100% 4.050 3.240 N TFDP1 n/a
4 TRCN0000274230 TCGACTGCAGCATCTCCAATG pLKO_005 907 CDS 100% 6.000 4.200 N TFDP1 n/a
5 TRCN0000019882 CGACAACCACATCTTACCAAA pLKO.1 539 CDS 100% 4.950 3.465 N TFDP1 n/a
6 TRCN0000019881 GTCTTCATAGACCAGAACCTT pLKO.1 260 5UTR 100% 3.000 2.100 N TFDP1 n/a
7 TRCN0000019880 CCTACGGCATTTCTCCATGAA pLKO.1 437 CDS 100% 4.950 2.970 N TFDP1 n/a
8 TRCN0000274229 CCTACGGCATTTCTCCATGAA pLKO_005 437 CDS 100% 4.950 2.970 N TFDP1 n/a
9 TRCN0000019883 GACGATGACTTCAACGAGAAT pLKO.1 1488 CDS 100% 4.950 2.970 N TFDP1 n/a
10 TRCN0000274180 GACGATGACTTCAACGAGAAT pLKO_005 1488 CDS 100% 4.950 2.970 N TFDP1 n/a
11 TRCN0000374166 AGGAGAAGAAGGAGATCAAAT pLKO_005 643 CDS 100% 13.200 9.240 N Tfdp1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011537519.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07051 pDONR223 100% 65.9% 64.4% None (many diffs) n/a
2 ccsbBroad304_07051 pLX_304 0% 65.9% 64.4% V5 (many diffs) n/a
3 TRCN0000480469 GTACCTAAGAGCTGAAACTACTCG pLX_317 22.1% 65.9% 64.4% V5 (many diffs) n/a
4 ccsbBroadEn_11969 pDONR223 100% 65.7% 57.7% None (many diffs) n/a
5 ccsbBroad304_11969 pLX_304 0% 65.7% 57.7% V5 (many diffs) n/a
6 TRCN0000479239 ACTATGCGCCGGTTCTTGCCCTCT pLX_317 42.6% 65.7% 57.7% V5 (many diffs) n/a
Download CSV