Construct: ORF TRCN0000480516
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF019051.3_s317c1
- Derived from:
- ccsbBroadEn_14649
- DNA Barcode:
- TTTGAGTTCGTACCGCCTCCTTGT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- FYN (2534)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000480516
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 2534 | FYN | FYN proto-oncogene, Src fam... | NM_153048.3 | 99.8% | 100% | 1445_1446delTG |
| 2 | human | 2534 | FYN | FYN proto-oncogene, Src fam... | XM_005266892.4 | 99.8% | 100% | 1445_1446delTG |
| 3 | human | 2534 | FYN | FYN proto-oncogene, Src fam... | NM_153047.4 | 90.1% | 90.2% | 697_852del;1601_1602delTG |
| 4 | human | 2534 | FYN | FYN proto-oncogene, Src fam... | NM_001370529.1 | 89.6% | 89.7% | 697_861del;1610_1611delTG |
| 5 | human | 2534 | FYN | FYN proto-oncogene, Src fam... | NM_002037.5 | 89.6% | 89.7% | 697_861del;1610_1611delTG |
| 6 | human | 2534 | FYN | FYN proto-oncogene, Src fam... | XM_017010650.1 | 89.6% | 89.7% | 697_861del;1610_1611delTG |
| 7 | human | 2534 | FYN | FYN proto-oncogene, Src fam... | XM_017010651.1 | 89.6% | 89.7% | 697_861del;1610_1611delTG |
| 8 | human | 2534 | FYN | FYN proto-oncogene, Src fam... | XM_017010652.1 | 89.6% | 89.7% | 697_861del;1610_1611delTG |
| 9 | human | 2534 | FYN | FYN proto-oncogene, Src fam... | XM_017010653.1 | 89.6% | 89.7% | 697_861del;1610_1611delTG |
| 10 | human | 2534 | FYN | FYN proto-oncogene, Src fam... | XM_017010655.2 | 58.9% | 48.9% | (many diffs) |
| 11 | mouse | 14360 | Fyn | Fyn proto-oncogene | NM_001122892.1 | 83.3% | 89.7% | (many diffs) |
| 12 | mouse | 14360 | Fyn | Fyn proto-oncogene | NM_008054.2 | 83.3% | 89.7% | (many diffs) |
| 13 | mouse | 14360 | Fyn | Fyn proto-oncogene | NM_001122893.1 | 82.9% | 89.1% | (many diffs) |
| 14 | mouse | 14360 | Fyn | Fyn proto-oncogene | XM_006512539.3 | 82.9% | 89.1% | (many diffs) |
| 15 | mouse | 14360 | Fyn | Fyn proto-oncogene | XM_006512540.3 | 82.9% | 89.1% | (many diffs) |
| 16 | mouse | 14360 | Fyn | Fyn proto-oncogene | XM_011243117.2 | 82.9% | 89.1% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1515
- ORF length:
- 1446
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gggctgtgtg caatgtaagg ataaagaagc aacaaaactg acggaggaga 121 gggacggcag cctgaaccag agctctgggt accgctatgg cacagacccc acccctcagc 181 actaccccag cttcggtgtg acctccatcc ccaactacaa caacttccac gcagccgggg 241 gccaaggact caccgtcttt ggaggtgtga actcttcgtc tcatacgggg accttgcgta 301 cgagaggagg aacaggagtg acactctttg tggcccttta tgactatgaa gcacggacag 361 aagatgacct gagttttcac aaaggagaaa aatttcaaat attgaacagc tcggaaggag 421 attggtggga agcccgctcc ttgacaactg gagagacagg ttacattccc agcaattatg 481 tggctccagt tgactctatc caggcagaag agtggtactt tggaaaactt ggccgaaaag 541 atgctgagcg acagctattg tcctttggaa acccaagagg tacctttctt atccgcgaga 601 gtgaaaccac caaaggtgcc tattcacttt ctatccgtga ttgggatgat atgaaaggag 661 accatgtcaa acattataaa attcgcaaac ttgacaatgg tggatactac attaccaccc 721 gggcccagtt tgaaacactt cagcagcttg tacaacatta ctcaggtacc tggaatggaa 781 acacaaaagt agccataaag actcttaaac caggcacaat gtcccccgaa tcattccttg 841 aggaagcgca gatcatgaag aagctgaagc acgacaagct ggtccagctc tatgcagtgg 901 tgtctgagga gcccatctac atcgtcaccg agtatatgaa caaaggaagt ttactggatt 961 tcttaaaaga tggagaagga agagctctga aattaccaaa tcttgtggac atggcagcac 1021 aggtggctgc aggaatggct tacatcgagc gcatgaatta tatccataga gatctgcgat 1081 cagcaaacat tctagtgggG AATGGACTCA TATGCAAGAT TGCTGACTTC GGATTGGCCC 1141 GATTGATAGA AGACAATGAG TACACAGCAA GACAAGGTGC AAAGTTCCCC ATCAAGTGGA 1201 CGGCCCCCGA GGCAGCCCTG TACGGGAGGT TCACAATCAA GTCTGACGTG TGGTCTTTTG 1261 GAATCTTACT CACAGAGCTG GTCACCAAAG GAAGAGTGCC ATACCCAGGC ATGAACAACC 1321 GGGAGGTGCT GGAGCAGGTG GAGCGAGGCT ACAGGATGCC CTGCCCGCAG GACTGCCCCA 1381 TCTCTCTGCA TGAGCTCATG ATCCACTGCT GGAAAAAGGA CCCTGAAGAA CGCCCCACTT 1441 TTGAGTACTT GCAGAGCTTC CTGGAAGACT ACTTTACCGC GACAGAGCCC CAGTACCAAC 1501 CTGGTGAAAA CCTGCCAACT TTCTTGTACA AAGTGGTTGA TATCGGTAAG CCTATCCCTA 1561 ACCCTCTCCT CGGTCTCGAT TCTACGTAGT AATGAACTAG TCCGTAACTT GAAAGTATTT 1621 CGATTTCTTG GCTTTATATA TCTTGTGGAA AGGACGATTT GAGTTCGTAC CGCCTCCTTG 1681 TACGCGTTAA GTCgacaatc aacctctgga ttacaaaatt tgtgaaagat t