Transcript: Mouse XM_006512540.3

PREDICTED: Mus musculus Fyn proto-oncogene (Fyn), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Fyn (14360)
Length:
3168
CDS:
474..2087

Additional Resources:

NCBI RefSeq record:
XM_006512540.3
NBCI Gene record:
Fyn (14360)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006512540.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000320616 CATCGAGCGCATGAATTATAT pLKO_005 1613 CDS 100% 15.000 21.000 N FYN n/a
2 TRCN0000361152 CATCGAGCGCATGAATTATAT pLKO_005 1613 CDS 100% 15.000 21.000 N Fyn n/a
3 TRCN0000361212 CACTGTTTGTGGCGCTTTATG pLKO_005 727 CDS 100% 13.200 18.480 N Fyn n/a
4 TRCN0000003100 CTTACCGATCTGTCTGTCAAA pLKO.1 1230 CDS 100% 4.950 3.960 N FYN n/a
5 TRCN0000361148 TCTGAGACAGAAGCGTGTTAT pLKO_005 2276 3UTR 100% 13.200 9.240 N Fyn n/a
6 TRCN0000023383 CATCCCGAACTACAACAACTT pLKO.1 611 CDS 100% 4.950 3.465 N Fyn n/a
7 TRCN0000023380 CCTGTATGGAAGGTTCACAAT pLKO.1 1787 CDS 100% 4.950 3.465 N Fyn n/a
8 TRCN0000003097 GCGATCAGCAAACATTCTAGT pLKO.1 1646 CDS 100% 4.950 3.465 N FYN n/a
9 TRCN0000023379 GCTCGGTTGATTGAAGACAAT pLKO.1 1707 CDS 100% 4.950 3.465 N Fyn n/a
10 TRCN0000023382 GCTCTGAAGTTGCCAAACCTT pLKO.1 1554 CDS 100% 3.000 2.100 N Fyn n/a
11 TRCN0000023381 CCTTTGGAAACCCAAGAGGTA pLKO.1 967 CDS 100% 2.640 1.848 N Fyn n/a
12 TRCN0000361149 TCTTCACCTGATTCAACTAAA pLKO_005 2441 3UTR 100% 13.200 7.920 N Fyn n/a
13 TRCN0000361213 TTGACAATGGTGGATACTATA pLKO_005 1096 CDS 100% 13.200 7.920 N Fyn n/a
14 TRCN0000380363 GGTTACATTCCCAGCAATTAT pLKO_005 864 CDS 100% 15.000 9.000 N FYN n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006512540.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488009 GTTTACTCCTAAGTCTCCATGTCG pLX_317 20.4% 93.2% 99.4% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000492351 TCATATCGCATTTTAACCAGCCTG pLX_317 13.8% 93.1% 99.2% V5 (many diffs) n/a
3 TRCN0000489800 GTTCATACCTAGACATTCCAGATT pLX_317 24.4% 93.1% 99.4% V5 (not translated due to prior stop codon) (many diffs) n/a
4 ccsbBroadEn_00600 pDONR223 100% 83% 89.1% None (many diffs) n/a
5 ccsbBroad304_00600 pLX_304 29.5% 83% 89.1% V5 (many diffs) n/a
6 TRCN0000480675 AAGCGACCCCAGTCACTCCCGACC pLX_317 28.5% 83% 89.1% V5 (many diffs) n/a
7 ccsbBroadEn_14649 pDONR223 0% 83% 89.1% None (many diffs) n/a
8 ccsbBroad304_14649 pLX_304 42.1% 82.9% 89.1% V5 (many diffs) n/a
9 TRCN0000480516 TTTGAGTTCGTACCGCCTCCTTGT pLX_317 28.8% 82.9% 89.1% V5 (many diffs) n/a
Download CSV