Transcript: Human NM_153048.3

Homo sapiens FYN proto-oncogene, Src family tyrosine kinase (FYN), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-06
Taxon:
Homo sapiens (human)
Gene:
FYN (2534)
Length:
2959
CDS:
104..1552

Additional Resources:

NCBI RefSeq record:
NM_153048.3
NBCI Gene record:
FYN (2534)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_153048.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000320616 CATCGAGCGCATGAATTATAT pLKO_005 1078 CDS 100% 15.000 21.000 N FYN n/a
2 TRCN0000361152 CATCGAGCGCATGAATTATAT pLKO_005 1078 CDS 100% 15.000 21.000 N Fyn n/a
3 TRCN0000380363 GGTTACATTCCCAGCAATTAT pLKO_005 494 CDS 100% 15.000 21.000 N FYN n/a
4 TRCN0000320549 TCGGATTGGCCCGATTGATAG pLKO_005 1164 CDS 100% 10.800 15.120 N FYN n/a
5 TRCN0000196446 GCGCATGAATTATATCCATAG pLKO.1 1084 CDS 100% 6.000 8.400 N FYN n/a
6 TRCN0000003097 GCGATCAGCAAACATTCTAGT pLKO.1 1111 CDS 100% 4.950 6.930 N FYN n/a
7 TRCN0000380636 GAACTTCCATGGCCCTCATTA pLKO_005 1687 3UTR 100% 13.200 9.240 N FYN n/a
8 TRCN0000320547 TCAGCAGCTTGTACAACATTA pLKO_005 775 CDS 100% 13.200 9.240 N FYN n/a
9 TRCN0000361149 TCTTCACCTGATTCAACTAAA pLKO_005 1909 3UTR 100% 13.200 9.240 N Fyn n/a
10 TRCN0000350336 TTCGAGACAGAACCTTGTTAT pLKO_005 1748 3UTR 100% 13.200 9.240 N FYN n/a
11 TRCN0000195583 CTGGAGAGACAGGTTACATTC pLKO.1 483 CDS 100% 10.800 7.560 N FYN n/a
12 TRCN0000197087 GAACAGGAGTGACACTCTTTG pLKO.1 345 CDS 100% 10.800 7.560 N FYN n/a
13 TRCN0000320546 TGTGAACTCTTCGTCTCATAC pLKO_005 301 CDS 100% 10.800 7.560 N FYN n/a
14 TRCN0000003098 GACTCTTAAACCAGGCACAAT pLKO.1 835 CDS 100% 4.950 3.465 N FYN n/a
15 TRCN0000003101 GTGCCAACAATCCTAGTGCTT pLKO.1 1847 3UTR 100% 2.640 1.848 N FYN n/a
16 TRCN0000023381 CCTTTGGAAACCCAAGAGGTA pLKO.1 597 CDS 100% 2.640 1.584 N Fyn n/a
17 TRCN0000003099 GCCTATTCACTTTCTATCCGT pLKO.1 653 CDS 100% 0.750 0.450 N FYN n/a
18 TRCN0000361213 TTGACAATGGTGGATACTATA pLKO_005 726 CDS 100% 13.200 6.600 Y Fyn n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_153048.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00600 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00600 pLX_304 29.5% 100% 100% V5 n/a
3 TRCN0000480675 AAGCGACCCCAGTCACTCCCGACC pLX_317 28.5% 100% 100% V5 n/a
4 ccsbBroadEn_14649 pDONR223 0% 100% 100% None n/a
5 ccsbBroad304_14649 pLX_304 42.1% 99.8% 100% V5 1445_1446delTG n/a
6 TRCN0000480516 TTTGAGTTCGTACCGCCTCCTTGT pLX_317 28.8% 99.8% 100% V5 1445_1446delTG n/a
7 TRCN0000488009 GTTTACTCCTAAGTCTCCATGTCG pLX_317 20.4% 89.7% 89.7% V5 (not translated due to prior stop codon) 696_697ins165 n/a
8 TRCN0000492351 TCATATCGCATTTTAACCAGCCTG pLX_317 13.8% 89.7% 89.5% V5 696_697ins165;1446_1447insG n/a
9 TRCN0000489800 GTTCATACCTAGACATTCCAGATT pLX_317 24.4% 89.6% 89.7% V5 (not translated due to prior stop codon) 12G>A;696_697ins165 n/a
Download CSV