Transcript: Human NM_001370529.1

Homo sapiens FYN proto-oncogene, Src family tyrosine kinase (FYN), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
FYN (2534)
Length:
3105
CDS:
85..1698

Additional Resources:

NCBI RefSeq record:
NM_001370529.1
NBCI Gene record:
FYN (2534)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001147423 TGGATACTACATTACCACCC pXPR_003 GGG 649 40% 6 1.3442 FYN FYN 77244
2 BRDN0001147691 ACGGGGACCTTGCGTACGAG pXPR_003 AGG 233 14% 2 -0.2836 FYN FYN 77243
3 BRDN0001145913 GTCCCCCGAATCATTCCTTG pXPR_003 AGG 934 58% 8 -0.2875 FYN FYN 77245
4 BRDN0001147012 TTGTCCTTTGGAAACCCAAG pXPR_003 AGG 506 31% 5 -0.5637 FYN FYN 77242
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001370529.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000320616 CATCGAGCGCATGAATTATAT pLKO_005 1224 CDS 100% 15.000 21.000 N FYN n/a
2 TRCN0000361152 CATCGAGCGCATGAATTATAT pLKO_005 1224 CDS 100% 15.000 21.000 N Fyn n/a
3 TRCN0000380363 GGTTACATTCCCAGCAATTAT pLKO_005 475 CDS 100% 15.000 21.000 N FYN n/a
4 TRCN0000320549 TCGGATTGGCCCGATTGATAG pLKO_005 1310 CDS 100% 10.800 15.120 N FYN n/a
5 TRCN0000196446 GCGCATGAATTATATCCATAG pLKO.1 1230 CDS 100% 6.000 8.400 N FYN n/a
6 TRCN0000003097 GCGATCAGCAAACATTCTAGT pLKO.1 1257 CDS 100% 4.950 6.930 N FYN n/a
7 TRCN0000380636 GAACTTCCATGGCCCTCATTA pLKO_005 1833 3UTR 100% 13.200 9.240 N FYN n/a
8 TRCN0000320547 TCAGCAGCTTGTACAACATTA pLKO_005 756 CDS 100% 13.200 9.240 N FYN n/a
9 TRCN0000361149 TCTTCACCTGATTCAACTAAA pLKO_005 2055 3UTR 100% 13.200 9.240 N Fyn n/a
10 TRCN0000350336 TTCGAGACAGAACCTTGTTAT pLKO_005 1894 3UTR 100% 13.200 9.240 N FYN n/a
11 TRCN0000195583 CTGGAGAGACAGGTTACATTC pLKO.1 464 CDS 100% 10.800 7.560 N FYN n/a
12 TRCN0000197087 GAACAGGAGTGACACTCTTTG pLKO.1 326 CDS 100% 10.800 7.560 N FYN n/a
13 TRCN0000320546 TGTGAACTCTTCGTCTCATAC pLKO_005 282 CDS 100% 10.800 7.560 N FYN n/a
14 TRCN0000003100 CTTACCGATCTGTCTGTCAAA pLKO.1 841 CDS 100% 4.950 3.465 N FYN n/a
15 TRCN0000003098 GACTCTTAAACCAGGCACAAT pLKO.1 981 CDS 100% 4.950 3.465 N FYN n/a
16 TRCN0000003101 GTGCCAACAATCCTAGTGCTT pLKO.1 1993 3UTR 100% 2.640 1.848 N FYN n/a
17 TRCN0000023381 CCTTTGGAAACCCAAGAGGTA pLKO.1 578 CDS 100% 2.640 1.584 N Fyn n/a
18 TRCN0000003099 GCCTATTCACTTTCTATCCGT pLKO.1 634 CDS 100% 0.750 0.450 N FYN n/a
19 TRCN0000361213 TTGACAATGGTGGATACTATA pLKO_005 707 CDS 100% 13.200 6.600 Y Fyn n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001370529.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488009 GTTTACTCCTAAGTCTCCATGTCG pLX_317 20.4% 100% 100% V5 (not translated due to prior stop codon) n/a
2 TRCN0000492351 TCATATCGCATTTTAACCAGCCTG pLX_317 13.8% 99.9% 99.8% V5 1611_1612insG n/a
3 TRCN0000489800 GTTCATACCTAGACATTCCAGATT pLX_317 24.4% 99.9% 100% V5 (not translated due to prior stop codon) 12G>A n/a
4 ccsbBroadEn_00600 pDONR223 100% 89.7% 89.7% None 697_861del n/a
5 ccsbBroad304_00600 pLX_304 29.5% 89.7% 89.7% V5 697_861del n/a
6 TRCN0000480675 AAGCGACCCCAGTCACTCCCGACC pLX_317 28.5% 89.7% 89.7% V5 697_861del n/a
7 ccsbBroadEn_14649 pDONR223 0% 89.7% 89.7% None 697_861del n/a
8 ccsbBroad304_14649 pLX_304 42.1% 89.6% 89.7% V5 697_861del;1610_1611delTG n/a
9 TRCN0000480516 TTTGAGTTCGTACCGCCTCCTTGT pLX_317 28.8% 89.6% 89.7% V5 697_861del;1610_1611delTG n/a
Download CSV