Construct: ORF TRCN0000480675
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF005476.2_s317c1
- Derived from:
- ccsbBroadEn_00600
- DNA Barcode:
- AAGCGACCCCAGTCACTCCCGACC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- FYN (2534)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000480675
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 2534 | FYN | FYN proto-oncogene, Src fam... | NM_153048.3 | 100% | 100% | |
| 2 | human | 2534 | FYN | FYN proto-oncogene, Src fam... | XM_005266892.4 | 100% | 100% | |
| 3 | human | 2534 | FYN | FYN proto-oncogene, Src fam... | NM_153047.4 | 90.2% | 90.2% | 697_852del |
| 4 | human | 2534 | FYN | FYN proto-oncogene, Src fam... | NM_001370529.1 | 89.7% | 89.7% | 697_861del |
| 5 | human | 2534 | FYN | FYN proto-oncogene, Src fam... | NM_002037.5 | 89.7% | 89.7% | 697_861del |
| 6 | human | 2534 | FYN | FYN proto-oncogene, Src fam... | XM_017010650.1 | 89.7% | 89.7% | 697_861del |
| 7 | human | 2534 | FYN | FYN proto-oncogene, Src fam... | XM_017010651.1 | 89.7% | 89.7% | 697_861del |
| 8 | human | 2534 | FYN | FYN proto-oncogene, Src fam... | XM_017010652.1 | 89.7% | 89.7% | 697_861del |
| 9 | human | 2534 | FYN | FYN proto-oncogene, Src fam... | XM_017010653.1 | 89.7% | 89.7% | 697_861del |
| 10 | human | 2534 | FYN | FYN proto-oncogene, Src fam... | XM_017010655.2 | 58.9% | 48.9% | (many diffs) |
| 11 | mouse | 14360 | Fyn | Fyn proto-oncogene | NM_001122892.1 | 83.5% | 89.7% | (many diffs) |
| 12 | mouse | 14360 | Fyn | Fyn proto-oncogene | NM_008054.2 | 83.5% | 89.7% | (many diffs) |
| 13 | mouse | 14360 | Fyn | Fyn proto-oncogene | NM_001122893.1 | 83% | 89.1% | (many diffs) |
| 14 | mouse | 14360 | Fyn | Fyn proto-oncogene | XM_006512539.3 | 83% | 89.1% | (many diffs) |
| 15 | mouse | 14360 | Fyn | Fyn proto-oncogene | XM_006512540.3 | 83% | 89.1% | (many diffs) |
| 16 | mouse | 14360 | Fyn | Fyn proto-oncogene | XM_011243117.2 | 83% | 89.1% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1512
- ORF length:
- 1446
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggg ctgtgtgcaa tgtaaggata aagaagcaac aaaactgacg gaggagaggg 121 acggcagcct gaaccagagc tctgggtacc gctatggcac agaccccacc cctcagcact 181 accccagctt cggtgtgacc tccatcccca actacaacaa cttccacgca gccgggggcc 241 aaggactcac cgtctttgga ggtgtgaact cttcgtctca tacggggacc ttgcgtacga 301 gaggaggaac aggagtgaca ctctttgtgg ccctttatga ctatgaagca cggacagaag 361 atgacctgag ttttcacaaa ggagaaaaat ttcaaatatt gaacagctcg gaaggagatt 421 ggtgggaagc ccgctccttg acaactggag agacaggtta cattcccagc aattatgtgg 481 ctccagttga ctctatccag gcagaagagt ggtactttgg aaaacttggc cgaaaagatg 541 ctgagcgaca gctattgtcc tttggaaacc caagaggtac ctttcttatc cgcgagagtg 601 aaaccaccaa aggtgcctat tcactttcta tccgtgattg ggatgatatg aaaggagacc 661 atgtcaaaca ttataaaatt cgcaaacttg acaatggtgg atactacatt accacccggg 721 cccagtttga aacacttcag cagcttgtac aacattactc aggtacctgg aatggaaaca 781 caaaagtagc cataaagact cttaaaccag gcacaatgtc ccccgaatca ttccttgagg 841 aagcgcagat catgaagaag ctgaagcacg acaagctggt ccagctctat gcagtggtgt 901 ctgaggagcc catctacatc gtcaccgagt atatgaacaa aggaagttta ctggatttct 961 taaaagatgg agaaggaaga gctctgaaat taccaaatct tgtggacatg gcagcacagg 1021 tggctgcagg aatggcttac atcgagcgca tgaattatat ccatagagat ctgcgatcag 1081 caaacattct agtggggaat ggacTCATAT GCAAGATTGC TGACTTCGGA TTGGCCCGAT 1141 TGATAGAAGA CAATGAGTAC ACAGCAAGAC AAGGTGCAAA GTTCCCCATC AAGTGGACGG 1201 CCCCCGAGGC AGCCCTGTAC GGGAGGTTCA CAATCAAGTC TGACGTGTGG TCTTTTGGAA 1261 TCTTACTCAC AGAGCTGGTC ACCAAAGGAA GAGTGCCATA CCCAGGCATG AACAACCGGG 1321 AGGTGCTGGA GCAGGTGGAG CGAGGCTACA GGATGCCCTG CCCGCAGGAC TGCCCCATCT 1381 CTCTGCATGA GCTCATGATC CACTGCTGGA AAAAGGACCC TGAAGAACGC CCCACTTTTG 1441 AGTACTTGCA GAGCTTCCTG GAAGACTACT TTACCGCGAC AGAGCCCCAG TACCAACCTG 1501 GTGAAAACCT GTACCCAACT TTCTTGTACA AAGTGGTTGA TATCGGTAAG CCTATCCCTA 1561 ACCCTCTCCT CGGTCTCGAT TCTACGTAGT AATGAACTAG TCCGTAACTT GAAAGTATTT 1621 CGATTTCTTG GCTTTATATA TCTTGTGGAA AGGACGAAAG CGACCCCAGT CACTCCCGAC 1681 CACGCGTTAA GTCgacaatc aacctctgga ttacaaaatt tgtgaaagat t