Construct: ORF TRCN0000480788
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF000636.2_s317c1
- Derived from:
- ccsbBroadEn_03631
- DNA Barcode:
- GTTTCCGTATTTGTTTGAAGGGCC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- LUC7L (55692)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000480788
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 55692 | LUC7L | LUC7 like | NM_001320226.1 | 100% | 100% | |
| 2 | human | 55692 | LUC7L | LUC7 like | NM_018032.5 | 100% | 100% | |
| 3 | human | 55692 | LUC7L | LUC7 like | XM_024450344.1 | 89.8% | 89.8% | 156_157ins99 |
| 4 | human | 55692 | LUC7L | LUC7 like | NM_201412.2 | 87.6% | 87.6% | 976_1113del |
| 5 | human | 55692 | LUC7L | LUC7 like | NM_001330420.1 | 83.6% | 83.6% | 0_1ins159 |
| 6 | human | 55692 | LUC7L | LUC7 like | XM_011522561.2 | 78.7% | 78.7% | 156_157ins99;877_1014del |
| 7 | human | 55692 | LUC7L | LUC7 like | XM_017023440.2 | 73.5% | 73.5% | 0_1ins258 |
| 8 | human | 55692 | LUC7L | LUC7 like | XM_005255427.3 | 73.3% | 73.3% | 0_1ins159;817_954del |
| 9 | human | 55692 | LUC7L | LUC7 like | XM_017023437.2 | 73.3% | 73.3% | 0_1ins159;817_954del |
| 10 | human | 55692 | LUC7L | LUC7 like | XM_005255429.3 | 64.4% | 64.4% | 0_1ins258;718_855del |
| 11 | human | 55692 | LUC7L | LUC7 like | XM_017023438.2 | 64.4% | 64.4% | 0_1ins258;718_855del |
| 12 | mouse | 66978 | Luc7l | Luc7-like | NM_025881.3 | 91.8% | 98.7% | (many diffs) |
| 13 | mouse | 66978 | Luc7l | Luc7-like | NM_028190.3 | 80.5% | 86.5% | (many diffs) |
| 14 | mouse | 66978 | Luc7l | Luc7-like | XM_017317615.1 | 66.4% | 72.2% | (many diffs) |
| 15 | mouse | 66978 | Luc7l | Luc7-like | NR_037905.1 | 50.6% | (many diffs) | |
| 16 | mouse | 66978 | Luc7l | Luc7-like | NR_037906.1 | 31.2% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1041
- ORF length:
- 975
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgtc cgcccaggcg cagatgcggg ccctgctgga ccagctcatg ggcacggctc 121 gggacggaga cgaaaccaga cagagggtca agtttacaga tgaccgtgtc tgcaagagtc 181 accttctgga ctgctgcccc catgacatcc tggctgggac gcgcatggat ttaggagaat 241 gtaccaaaat ccacgacttg gccctccgag cagattatga gattgcaagt aaagaaagag 301 acctgttttt tgaattagat gcaatggatc acttggagtc ctttattgct gaatgtgatc 361 ggagaactga gctcgccaag aagcggctgg cagaaacaca ggaggaaatc agtgcggaag 421 tttctgcaaa ggcagaaaaa gtacatgagt taaatgaaga aataggaaaa ctccttgcta 481 aagccgaaca gctaggggct gaaggtaatg tggatgaatc ccagaagatt cttatggaag 541 tggaaaaagt tcgtgcgaaG AAAAAAGAAG CTGAGGAAGA ATACAGAAAT TCCATGCCTG 601 CATCCAGTTT TCAGCAGCAA AAGCTGCGTG TCTGCGAGGT CTGTTCAGCC TACCTTGGTC 661 TCCATGACAA TGACCGTCGC CTGGCAGACC ACTTCGGTGG CAAGTTACAC TTGGGGTTCA 721 TTCAGATCCG AGAGAAGCTT GATCAGTTGA GGAAAACTGT CGCTGAAAAG CAGGAGAAGA 781 GAAATCAGGA TCGCTTGAGG AGGAGAGAGG AGAGGGAACG GGAGGAGCGT CTGAGCAGGA 841 GGTCGGGATC AAGAACCAGA GATCGCAGGA GGTCACGCTC CCGGGATCGG CGTCGGAGGC 901 GGTCAAGATC TACCTCCCGA GAGCGACGGA AATTGTCCCG GTCCCGGTCC CGAGATAGAC 961 ATCGGCGCCA CCGCAGCCGT TCCCGGAGCC ACAGCCGGGG ACATCGTCGG GCTTCCCGGG 1021 ACCGAAGTGC GAAATACAAG TACCCAACTT TCTTGTACAA AGTGGTTGAT ATCGGTAAGC 1081 CTATCCCTAA CCCTCTCCTC GGTCTCGATT CTACGTAGTA ATGAACTAGT CCGTAACTTG 1141 AAAGTATTTC GATTTCTTGG CTTTATATAT CTTGTGGAAA GGACGAGTTT CCGTATTTGT 1201 TTGAAGGGCC ACGCGTTAAG TCgacaatca acctctggat tacaaaattt gtgaaagatt