Transcript: Human XM_017023440.2

PREDICTED: Homo sapiens LUC7 like (LUC7L), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LUC7L (55692)
Length:
2622
CDS:
1499..2218

Additional Resources:

NCBI RefSeq record:
XM_017023440.2
NBCI Gene record:
LUC7L (55692)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017023440.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000001196 CCGAAGTGCGAAATACAAGTA pLKO.1 2197 CDS 100% 4.950 6.930 N LUC7L n/a
2 TRCN0000098932 CGCATGGATTTAGGAGAATGT pLKO.1 1333 5UTR 100% 4.950 6.930 N Luc7l n/a
3 TRCN0000098931 CGCGCATGGATTTAGGAGAAT pLKO.1 1331 5UTR 100% 4.950 6.930 N Luc7l n/a
4 TRCN0000199238 CGAGGTCTGTTCAGCCTACCT pLKO.1 1810 CDS 100% 0.880 1.232 N LUC7L n/a
5 TRCN0000314895 CGAGGTCTGTTCAGCCTACCT pLKO_005 1810 CDS 100% 0.880 1.232 N LUC7L n/a
6 TRCN0000001197 GAGGAAATCAGTGCGGAAGTT pLKO.1 1577 CDS 100% 4.950 3.960 N LUC7L n/a
7 TRCN0000314966 GAGGAAATCAGTGCGGAAGTT pLKO_005 1577 CDS 100% 4.950 3.960 N LUC7L n/a
8 TRCN0000195589 CCAGACAGAGGGTCAAGTTTA pLKO.1 1247 5UTR 100% 13.200 9.240 N LUC7L n/a
9 TRCN0000196353 GTGCTGTAAATAGTCTGATAA pLKO.1 2407 3UTR 100% 13.200 9.240 N LUC7L n/a
10 TRCN0000098934 CAGAGGGTCAAGTTTACAGAT pLKO.1 1252 5UTR 100% 4.950 3.465 N Luc7l n/a
11 TRCN0000001199 CAGATTATGAGATTGCAAGTA pLKO.1 1382 5UTR 100% 4.950 3.465 N LUC7L n/a
12 TRCN0000196755 GAGTCCTTTATTGCTGAATGT pLKO.1 1511 CDS 100% 4.950 3.465 N LUC7L n/a
13 TRCN0000001198 GCTGAATGTGATCGGAGAACT pLKO.1 1523 CDS 100% 4.950 3.465 N LUC7L n/a
14 TRCN0000314973 GCTGAATGTGATCGGAGAACT pLKO_005 1523 CDS 100% 4.950 3.465 N LUC7L n/a
15 TRCN0000314968 GATTATGAGATTGCAAGTAAA pLKO_005 1384 5UTR 100% 13.200 7.920 N LUC7L n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017023440.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03631 pDONR223 100% 73.5% 73.5% None 0_1ins258 n/a
2 ccsbBroad304_03631 pLX_304 0% 73.5% 73.5% V5 0_1ins258 n/a
3 TRCN0000480788 GTTTCCGTATTTGTTTGAAGGGCC pLX_317 49.4% 73.5% 73.5% V5 0_1ins258 n/a
4 ccsbBroadEn_12253 pDONR223 100% 67.5% 67.5% None 0_1ins207;717_718ins138 n/a
5 ccsbBroad304_12253 pLX_304 0% 67.5% 67.5% V5 0_1ins207;717_718ins138 n/a
6 TRCN0000478765 AGCCCGTGCAGGGCAGAATCAGTC pLX_317 42.7% 67.5% 67.5% V5 0_1ins207;717_718ins138 n/a
Download CSV