Transcript: Human XM_017023437.2

PREDICTED: Homo sapiens LUC7 like (LUC7L), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LUC7L (55692)
Length:
2519
CDS:
1336..2292

Additional Resources:

NCBI RefSeq record:
XM_017023437.2
NBCI Gene record:
LUC7L (55692)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017023437.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000098932 CGCATGGATTTAGGAGAATGT pLKO.1 1333 5UTR 100% 4.950 6.930 N Luc7l n/a
2 TRCN0000098931 CGCGCATGGATTTAGGAGAAT pLKO.1 1331 5UTR 100% 4.950 6.930 N Luc7l n/a
3 TRCN0000199238 CGAGGTCTGTTCAGCCTACCT pLKO.1 1746 CDS 100% 0.880 1.232 N LUC7L n/a
4 TRCN0000314895 CGAGGTCTGTTCAGCCTACCT pLKO_005 1746 CDS 100% 0.880 1.232 N LUC7L n/a
5 TRCN0000001197 GAGGAAATCAGTGCGGAAGTT pLKO.1 1513 CDS 100% 4.950 3.960 N LUC7L n/a
6 TRCN0000314966 GAGGAAATCAGTGCGGAAGTT pLKO_005 1513 CDS 100% 4.950 3.960 N LUC7L n/a
7 TRCN0000195589 CCAGACAGAGGGTCAAGTTTA pLKO.1 1247 5UTR 100% 13.200 9.240 N LUC7L n/a
8 TRCN0000196353 GTGCTGTAAATAGTCTGATAA pLKO.1 2306 3UTR 100% 13.200 9.240 N LUC7L n/a
9 TRCN0000098934 CAGAGGGTCAAGTTTACAGAT pLKO.1 1252 5UTR 100% 4.950 3.465 N Luc7l n/a
10 TRCN0000001199 CAGATTATGAGATTGCAAGTA pLKO.1 1382 CDS 100% 4.950 3.465 N LUC7L n/a
11 TRCN0000196755 GAGTCCTTTATTGCTGAATGT pLKO.1 1447 CDS 100% 4.950 3.465 N LUC7L n/a
12 TRCN0000001198 GCTGAATGTGATCGGAGAACT pLKO.1 1459 CDS 100% 4.950 3.465 N LUC7L n/a
13 TRCN0000314973 GCTGAATGTGATCGGAGAACT pLKO_005 1459 CDS 100% 4.950 3.465 N LUC7L n/a
14 TRCN0000314968 GATTATGAGATTGCAAGTAAA pLKO_005 1384 CDS 100% 13.200 7.920 N LUC7L n/a
15 TRCN0000001196 CCGAAGTGCGAAATACAAGTA pLKO.1 2133 CDS 100% 4.950 6.930 N LUC7L n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017023437.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12253 pDONR223 100% 89.8% 89.8% None 0_1ins108 n/a
2 ccsbBroad304_12253 pLX_304 0% 89.8% 89.8% V5 0_1ins108 n/a
3 TRCN0000478765 AGCCCGTGCAGGGCAGAATCAGTC pLX_317 42.7% 89.8% 89.8% V5 0_1ins108 n/a
4 ccsbBroadEn_03631 pDONR223 100% 73.3% 73.3% None 0_1ins159;817_954del n/a
5 ccsbBroad304_03631 pLX_304 0% 73.3% 73.3% V5 0_1ins159;817_954del n/a
6 TRCN0000480788 GTTTCCGTATTTGTTTGAAGGGCC pLX_317 49.4% 73.3% 73.3% V5 0_1ins159;817_954del n/a
Download CSV