Transcript: Mouse XM_017317615.1

PREDICTED: Mus musculus Luc7-like (Luc7l), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Luc7l (66978)
Length:
5063
CDS:
363..1319

Additional Resources:

NCBI RefSeq record:
XM_017317615.1
NBCI Gene record:
Luc7l (66978)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017317615.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000311438 ACTCCGTGTTTGCGAGGTTTG pLKO_005 761 CDS 100% 6.000 8.400 N Luc7l n/a
2 TRCN0000098932 CGCATGGATTTAGGAGAATGT pLKO.1 360 5UTR 100% 4.950 3.960 N Luc7l n/a
3 TRCN0000098931 CGCGCATGGATTTAGGAGAAT pLKO.1 358 5UTR 100% 4.950 3.960 N Luc7l n/a
4 TRCN0000195589 CCAGACAGAGGGTCAAGTTTA pLKO.1 274 5UTR 100% 13.200 9.240 N LUC7L n/a
5 TRCN0000305979 CTTCGAGCAGATTATGAAATT pLKO_005 402 CDS 100% 13.200 9.240 N Luc7l n/a
6 TRCN0000305978 TCCAGATCCCGAGATAGATAC pLKO_005 1080 CDS 100% 10.800 7.560 N Luc7l n/a
7 TRCN0000098933 CAGGAGGAAATCAGTGCAGAA pLKO.1 537 CDS 100% 4.050 2.835 N Luc7l n/a
8 TRCN0000325357 CAGGAGGAAATCAGTGCAGAA pLKO_005 537 CDS 100% 4.050 2.835 N Luc7l n/a
9 TRCN0000098934 CAGAGGGTCAAGTTTACAGAT pLKO.1 279 5UTR 100% 4.950 2.970 N Luc7l n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017317615.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12253 pDONR223 100% 80.3% 86.7% None (many diffs) n/a
2 ccsbBroad304_12253 pLX_304 0% 80.3% 86.7% V5 (many diffs) n/a
3 TRCN0000478765 AGCCCGTGCAGGGCAGAATCAGTC pLX_317 42.7% 80.3% 86.7% V5 (many diffs) n/a
4 ccsbBroadEn_03631 pDONR223 100% 66.4% 72.2% None (many diffs) n/a
5 ccsbBroad304_03631 pLX_304 0% 66.4% 72.2% V5 (many diffs) n/a
6 TRCN0000480788 GTTTCCGTATTTGTTTGAAGGGCC pLX_317 49.4% 66.4% 72.2% V5 (many diffs) n/a
Download CSV