Transcript: Human NM_001320226.1

Homo sapiens LUC7 like (LUC7L), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-05
Taxon:
Homo sapiens (human)
Gene:
LUC7L (55692)
Length:
1530
CDS:
144..1121

Additional Resources:

NCBI RefSeq record:
NM_001320226.1
NBCI Gene record:
LUC7L (55692)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001320226.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000001196 CCGAAGTGCGAAATACAAGTA pLKO.1 1100 CDS 100% 4.950 6.930 N LUC7L n/a
2 TRCN0000098932 CGCATGGATTTAGGAGAATGT pLKO.1 300 CDS 100% 4.950 6.930 N Luc7l n/a
3 TRCN0000098931 CGCGCATGGATTTAGGAGAAT pLKO.1 298 CDS 100% 4.950 6.930 N Luc7l n/a
4 TRCN0000199238 CGAGGTCTGTTCAGCCTACCT pLKO.1 713 CDS 100% 0.880 1.232 N LUC7L n/a
5 TRCN0000314895 CGAGGTCTGTTCAGCCTACCT pLKO_005 713 CDS 100% 0.880 1.232 N LUC7L n/a
6 TRCN0000001197 GAGGAAATCAGTGCGGAAGTT pLKO.1 480 CDS 100% 4.950 3.960 N LUC7L n/a
7 TRCN0000314966 GAGGAAATCAGTGCGGAAGTT pLKO_005 480 CDS 100% 4.950 3.960 N LUC7L n/a
8 TRCN0000195589 CCAGACAGAGGGTCAAGTTTA pLKO.1 214 CDS 100% 13.200 9.240 N LUC7L n/a
9 TRCN0000196353 GTGCTGTAAATAGTCTGATAA pLKO.1 1310 3UTR 100% 13.200 9.240 N LUC7L n/a
10 TRCN0000098934 CAGAGGGTCAAGTTTACAGAT pLKO.1 219 CDS 100% 4.950 3.465 N Luc7l n/a
11 TRCN0000001199 CAGATTATGAGATTGCAAGTA pLKO.1 349 CDS 100% 4.950 3.465 N LUC7L n/a
12 TRCN0000196755 GAGTCCTTTATTGCTGAATGT pLKO.1 414 CDS 100% 4.950 3.465 N LUC7L n/a
13 TRCN0000001198 GCTGAATGTGATCGGAGAACT pLKO.1 426 CDS 100% 4.950 3.465 N LUC7L n/a
14 TRCN0000314973 GCTGAATGTGATCGGAGAACT pLKO_005 426 CDS 100% 4.950 3.465 N LUC7L n/a
15 TRCN0000314968 GATTATGAGATTGCAAGTAAA pLKO_005 351 CDS 100% 13.200 7.920 N LUC7L n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001320226.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03631 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03631 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000480788 GTTTCCGTATTTGTTTGAAGGGCC pLX_317 49.4% 100% 100% V5 n/a
4 ccsbBroadEn_12253 pDONR223 100% 83% 82.2% None 3_14del;22_60del;975_976ins138 n/a
5 ccsbBroad304_12253 pLX_304 0% 83% 82.2% V5 3_14del;22_60del;975_976ins138 n/a
6 TRCN0000478765 AGCCCGTGCAGGGCAGAATCAGTC pLX_317 42.7% 83% 82.2% V5 3_14del;22_60del;975_976ins138 n/a
Download CSV