Construct: ORF TRCN0000480973
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF007906.2_s317c1
- Derived from:
- ccsbBroadEn_14269
- DNA Barcode:
- GTTGCTATTCGAGCTCAACGTCCT
- Epitope Tag:
- V5 (not translated due to frame shift)
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- NARS2 (79731)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000480973
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 79731 | NARS2 | asparaginyl-tRNA synthetase... | NM_024678.6 | 99.7% | 98.9% | 260A>C;414T>C;1419delT |
2 | human | 79731 | NARS2 | asparaginyl-tRNA synthetase... | XM_011545253.2 | 97.9% | 97% | (many diffs) |
3 | human | 79731 | NARS2 | asparaginyl-tRNA synthetase... | XM_017018302.2 | 64.7% | 64.1% | (many diffs) |
4 | human | 79731 | NARS2 | asparaginyl-tRNA synthetase... | XR_001747964.2 | 57.1% | (many diffs) | |
5 | human | 79731 | NARS2 | asparaginyl-tRNA synthetase... | XR_001747965.2 | 56.1% | (many diffs) | |
6 | human | 79731 | NARS2 | asparaginyl-tRNA synthetase... | XR_001747966.2 | 55.8% | (many diffs) | |
7 | human | 79731 | NARS2 | asparaginyl-tRNA synthetase... | NM_001243251.1 | 52.3% | 51.5% | 0_1ins681;738delT |
8 | human | 79731 | NARS2 | asparaginyl-tRNA synthetase... | XM_017018303.1 | 52.3% | 51.5% | 0_1ins681;738delT |
9 | human | 79731 | NARS2 | asparaginyl-tRNA synthetase... | XM_017018304.2 | 50.4% | 49.6% | 0_1ins681;580_581ins27;711delT |
10 | human | 79731 | NARS2 | asparaginyl-tRNA synthetase... | XR_001747963.2 | 33.4% | (many diffs) | |
11 | mouse | 244141 | Nars2 | asparaginyl-tRNA synthetase... | NM_153591.4 | 85.5% | 83.8% | (many diffs) |
12 | mouse | 244141 | Nars2 | asparaginyl-tRNA synthetase... | XM_017322252.1 | 78.9% | 77.3% | (many diffs) |
13 | mouse | 244141 | Nars2 | asparaginyl-tRNA synthetase... | XM_006507816.1 | 77.3% | 75.6% | (many diffs) |
14 | mouse | 244141 | Nars2 | asparaginyl-tRNA synthetase... | XM_006507817.3 | 74.6% | 72.2% | (many diffs) |
15 | mouse | 244141 | Nars2 | asparaginyl-tRNA synthetase... | XM_011241794.2 | 51.4% | 51.1% | (many diffs) |
16 | mouse | 244141 | Nars2 | asparaginyl-tRNA synthetase... | XR_001785547.1 | 50% | (many diffs) | |
17 | mouse | 244141 | Nars2 | asparaginyl-tRNA synthetase... | XM_006507821.2 | 49.4% | 45.8% | (many diffs) |
18 | mouse | 244141 | Nars2 | asparaginyl-tRNA synthetase... | XR_001785548.1 | 48.8% | (many diffs) | |
19 | mouse | 244141 | Nars2 | asparaginyl-tRNA synthetase... | XR_001785555.1 | 48.6% | (many diffs) | |
20 | mouse | 244141 | Nars2 | asparaginyl-tRNA synthetase... | XR_378243.1 | 47.6% | (many diffs) | |
21 | mouse | 244141 | Nars2 | asparaginyl-tRNA synthetase... | XR_001785557.1 | 47.4% | (many diffs) | |
22 | mouse | 244141 | Nars2 | asparaginyl-tRNA synthetase... | XR_001785553.1 | 47.4% | (many diffs) | |
23 | mouse | 244141 | Nars2 | asparaginyl-tRNA synthetase... | XR_001785554.1 | 46.3% | (many diffs) | |
24 | mouse | 244141 | Nars2 | asparaginyl-tRNA synthetase... | XR_001785550.1 | 44.8% | (many diffs) | |
25 | mouse | 244141 | Nars2 | asparaginyl-tRNA synthetase... | XR_001785549.1 | 44.3% | (many diffs) | |
26 | mouse | 244141 | Nars2 | asparaginyl-tRNA synthetase... | XR_001785556.1 | 44% | (many diffs) | |
27 | mouse | 244141 | Nars2 | asparaginyl-tRNA synthetase... | XR_001785551.1 | 43.8% | (many diffs) | |
28 | mouse | 244141 | Nars2 | asparaginyl-tRNA synthetase... | XR_001785558.1 | 43% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1497
- ORF length:
- 1431
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgct gggggtccgc tgcctgctgc ggtccgtgcg cttctgttcc tccgccccct 121 tccccaagca caaaccttca gccaaactga gcgtgcggga cgctctcggg gctcagaacg 181 cgagtgggga gcgcattaag atccagggat ggattcgttc tgtccgatcc cagaaggaag 241 tcttgttcct gcatgtaaat gatgggtcat ctttggaaag ccttcaggtt gttgcagatt 301 caggccttga cagtagagaa ttaacttttg ggagttctgt ggaagtacaa gggcagctga 361 taaaaagtcc atccaaaagg caaaatgtgg aactgaaggc agaaaaaatt aaagttattg 421 gaaattgtga tgccaaggat ttccccatca aatataaaga gaggcatcct ctggagtacc 481 tgcgacaata tcctcacttt aggtgtagga ctaacgttct gggttctata ttgaggattc 541 gcagtgaagc gacagctgct attcattctt tctttaagga cagtggcttt gtacatattc 601 atactccaat aatcacatcc aatgactctg agggagctgg agaacttttt caacttgaac 661 cttcaggcaa acttaaggta cctgaggaga atttcttcaa tgttcctgct ttcttaactg 721 tctcaggaca acttcatcta gaagtgatgt caggagcttt tactcaagtg tttacctttg 781 gtccgacctt ccgagctgaa aattctcaga gccggaggca cctggcagag ttttatatga 841 tagaagcaga gatttctttt gttgacagcc ttcaagatct tatgcaggtt atagaggaac 901 tgttcaaggc tacaacaatg atggttctct caaaatgtcc tgaagatgtt gaactctgtc 961 acaaattcat agcacctggc caaaaggaca gattagaaca tatgctaaaa aacaactttt 1021 taatcatttc ttatactgaa gcagtggaga tcttaaagca agcatcccag aacttcacct 1081 ttaccccaga gtggggtgct gaccTACGGA CTGAACATGA AAAGTACCTG GTGAAGCACT 1141 GTGGCAACAT ACCTGTCTTC GTTATTAATT ATCCATTAAC ACTCAAGCCT TTCTACATGA 1201 GGGATAATGA AGATGGCCCT CAGCACACGG TTGCTGCTGT TGATCTTCTG GTTCCTGGAG 1261 TTGGGGAACT CTTTGGAGGA GGCCTCAGAG AAGAACGATA CCATTTCTTA GAGGAGCGCT 1321 TAGCCAGATC GGGACTTACA GAAGTCTACC AATGGTATCT GGACCTTCGT CGATTTGGAT 1381 CTGTGCCACA TGGAGGTTTT GGGATGGGAT TTGAACGCTA CCTGCAGTGC ATCTTGGGTG 1441 TTGACAATAT CAAAGATGTT ATCCCTTTCC CAAGGTTTCC TCATCATGCC TTTTATACCC 1501 AACTTTCTTG TACAAAGTGG TTGATATCGG TAAGCCTATC CCTAACCCTC TCCTCGGTCT 1561 CGATTCTACG TAGTAATGAA CTAGTCCGTA ACTTGAAAGT ATTTCGATTT CTTGGCTTTA 1621 TATATCTTGT GGAAAGGACG AGTTGCTATT CGAGCTCAAC GTCCTACGCG TTAAGTCgac 1681 aatcaacctc tggattacaa aatttgtgaa agatt