Transcript: Human XR_001747963.2

PREDICTED: Homo sapiens asparaginyl-tRNA synthetase 2, mitochondrial (NARS2), transcript variant X2, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NARS2 (79731)
Length:
4161
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001747963.2
NBCI Gene record:
NARS2 (79731)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001747963.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000232608 ACATACCTGTCTTCGTTATTA pLKO_005 1436 3UTR 100% 15.000 21.000 N NARS2 n/a
2 TRCN0000232607 CAAGATCTTATGCAGGTTATA pLKO_005 1162 3UTR 100% 13.200 18.480 N NARS2 n/a
3 TRCN0000162022 GCAACATACCTGTCTTCGTTA pLKO.1 1433 3UTR 100% 4.950 6.930 N NARS2 n/a
4 TRCN0000162541 GTTATCCCTTTCCCAAGGTTT pLKO.1 3420 3UTR 100% 4.950 6.930 N NARS2 n/a
5 TRCN0000163609 CCCGCAAGAAGAGGTACTTAT pLKO.1 3658 3UTR 100% 13.200 10.560 N NARS2 n/a
6 TRCN0000232609 CCCGCAAGAAGAGGTACTTAT pLKO_005 3658 3UTR 100% 13.200 10.560 N NARS2 n/a
7 TRCN0000232606 CTAACGTTCTGGGTTCTATAT pLKO_005 800 3UTR 100% 13.200 9.240 N NARS2 n/a
8 TRCN0000163237 GCAGAGACACTGCACATGATT pLKO.1 3496 3UTR 100% 5.625 3.938 N NARS2 n/a
9 TRCN0000161788 CTGCGACAATATCCTCACTTT pLKO.1 769 3UTR 100% 4.950 3.465 N NARS2 n/a
10 TRCN0000163533 GCCTTCAGGTTGTTGCAGATT pLKO.1 569 3UTR 100% 4.950 3.465 N NARS2 n/a
11 TRCN0000163736 GTGAAGCACTGTGGCAACATA pLKO.1 1420 3UTR 100% 5.625 3.375 N NARS2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001747963.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14269 pDONR223 100% 33.4% None (many diffs) n/a
2 ccsbBroad304_14269 pLX_304 0% 33.4% V5 (not translated due to frame shift) (many diffs) n/a
3 TRCN0000480973 GTTGCTATTCGAGCTCAACGTCCT pLX_317 27.7% 33.4% V5 (not translated due to frame shift) (many diffs) n/a
Download CSV